Direct conversion of reactive glial cells to neurons is a promising avenue for neuronal replacement therapies after brain injury or neurodegeneration. The overexpression of neurogenic fate determinants in glial cells results in conversion to neurons. For repair purposes, the conversion should ideally be induced in the pathology-induced neuroinflammatory environment. However, very little is known regarding

Monocots possess a fibrous root system comprising an embryonic root, crown roots, and lateral roots. The distinct cellular origins highlight the diversity of the initiation mechanism. To date, the distinct initiation mechanisms have been poorly studied. In this study, we conduct a comprehensive transcriptome and DNA methylome assay of these root types during their initiation. Our findings indicate

Mutational signatures are typically identified from tumor genome sequencing data using non-negative matrix factorization (NMF). However, existing NMF techniques only decompose a single dataset, limiting rigorous comparisons of signatures across conditions. We propose a Bayesian NMF method that jointly decomposes multiple datasets to identify signatures and their sharing pattern across conditions. We

Computational methods for assessing the likely impacts of mutations, known as variant effect predictors (VEPs), are widely used in the assessment and interpretation of human genetic variation, as well as in other applications like protein engineering. Many different VEPs have been released, and there is tremendous variability in their underlying algorithms, outputs, and the ways in which the methodologies

After Cas12a cleaves its DNA target, it generates a DNA double strand break (DSB) with two compatible 5′-staggered ends. The Cas12a-gRNA complex remains at the protospacer adjacent motif (PAM)-proximal end (PPE) while releasing the PAM-distal end (PDE). The effects of this asymmetric retention on DSB repair are currently unknown. Post-cleavage retention of LbCas12a at PPEs suppresses the recruitment

MicroRNAs are released from cells in extracellular vesicles (EVs), representing an essential mode of cell–cell communication (CCC) via a regulatory effect on gene expression. Single-cell RNA-sequencing technologies have ushered in an era of elucidating CCC at single-cell resolution. Herein, we present miRTalk, a pioneering approach for inferring CCC mediated by EV-derived miRNA-target interactions

Long-term persistence of species with low genetic diversity is the focus of widespread attention in conservation biology. The snow leopard, Panthera uncia, is a big cat from high-alpine regions of Asia. However, its subspecies taxonomy, evolutionary history, evolutionary potential, and survival strategy remain unclear, which greatly hampers their conservation. We sequence a high-quality chromosome-level

Cereal grain size and quality are critical agronomic traits in crop production. Wheat grain development is governed by intricate regulatory networks that require precise spatiotemporal coordination of gene expression to establish functional compartments in different cell types. Here, we perform a spatial transcriptomics study covering the early stages of wheat grain development, from 4 to 12 days after

TF Profiler is a method of inferring transcription factor (TF) regulatory activity, i.e., when a TF is present and actively participating in the regulation of transcription, directly from nascent sequencing assays such as PRO-seq and GRO-seq. While ChIP assays have measured DNA localization, they fall short of identifying when and where the effector domain of a transcription factor is active. Our method

Single-cell transcriptomics has transformed our understanding of cellular diversity, yet noise from technical artifacts and low-quality cells can obscure key biological signals. A common practice is filtering out cells with a high percentage of mitochondrial RNA counts (pctMT), typically indicative of cell death. However, commonly used filtering thresholds, primarily derived from studies on healthy

High-throughput multi-omic molecular profiling allows the probing of biological systems at unprecedented resolution. However, integrating and interpreting high-dimensional, sparse, and noisy multimodal datasets remains challenging. Deriving new biological insights with current methods is difficult because they are not rooted in biological principles but prioritise tasks like dimensionality reduction

Spatial and temporal control of DNA damage response pathways after DNA damage is crucial for maintenance of genomic stability. Ataxia telangiectasia mutated (ATM) protein plays a central role in DNA damage response pathways. The chain of events following induction of DNA damage that results in full activation of ATM is still evolving. Here we set out to explore the role of CREB-binding protein (CBP)

Cellular deconvolution of bulk RNA-sequencing data using single cell/nuclei RNA-seq reference data is an important strategy for estimating cell type composition in heterogeneous tissues, such as the human brain. Here, we generate a multi-assay dataset in postmortem human dorsolateral prefrontal cortex from 22 tissue blocks, including bulk RNA-seq, reference snRNA-seq, and orthogonal measurement of

Low-pass single-cell DNA sequencing technologies and algorithmic advancements have enabled haplotype-specific copy number calling on thousands of cells within tumors. However, measurement uncertainty may result in spurious CNAs inconsistent with realistic evolutionary constraints. We introduce evolution-aware copy number calling via deep reinforcement learning (CNRein). Our simulations demonstrate

Advancements in RNA sequencing have expanded our ability to study gene expression profiles of biological samples in bulk tissue and single cells. Deconvolution of bulk data with single-cell references provides the ability to study relative cell-type proportions, but most methods assume a reference is present for every cell type in bulk data. This is not true in all circumstances—cell types can be missing

The Cre-Lox system is a powerful tool in mouse genetics, enabling precise spatiotemporal control of gene expression and conditional knockout models. Since its development, it has transformed genome editing by facilitating targeted deletions, translocations, inversions, and complex modifications—double-floxed inverse orientation. Its utility extends beyond mice to rats, pigs, and zebrafish. However

Genomic prediction encompasses the techniques used in agricultural technology to predict the genetic merit of individuals towards valuable phenotypic traits. It is related to Genome Interpretation in humans, which models the individual risk of developing disease traits. Genomic prediction is dominated by linear mixed models, such as the Genomic Best Linear Unbiased Prediction (GBLUP), which computes

The fatty acid content represents a crucial quality trait in Brassica napus or rapeseed. Improvements in fatty acid composition markedly enhance the quality of rapeseed oil. Here, we perform a genome-wide association study (GWAS) to identify quantitative trait locus (QTLs) associated with fatty acid content. We identify a total of seven stable QTLs and find two loci, qFA.A08 and qFA.A09.1, subjected

Ophiuroids, belonging to Ophiuroidea in Echinodermata, possess remarkable regenerative capacities in their arms, relying on cellular recruitment and de-differentiation. However, limited high-quality genomic resources have hindered the investigation of the underlying molecular mechanisms of ophiuroid regeneration. Here, we report a chromosome-level genome of Ophiura sarsii vadicola, 259.28 Mbp in length

Understanding the genetic causes underlying variability in chromatin accessibility can shed light on the molecular mechanisms through which genetic variants may affect complex traits. Thousands of ATAC-seq samples have been collected that hold information about chromatin accessibility across diverse cell types and contexts, but most of these are not paired with genetic information and come from distinct

Advances in spatial omics enable deeper insights into tissue microenvironments while posing computational challenges. Therefore, we developed SOAPy, a comprehensive tool for analyzing spatial omics data, which offers methods for spatial domain identification, spatial expression tendency, spatiotemporal expression pattern, cellular co-localization, multi-cellular niches, cell–cell communication, and

Genome-scale metabolic models (GSMMs) are used to predict metabolic fluxes, with applications ranging from identifying novel drug targets to engineering microbial metabolism. Erroneous or missing reactions, scattered throughout densely interconnected networks, are a limiting factor in these applications. We present Metabolic Accuracy Check and Analysis Workflow (MACAW), a suite of algorithms that helps

Correction: Genome Biol 26, 61 (2025) https://doi.org/10.1186/s13059-025–03535-4 Following publication of the original article [1], the authors identified a typesetting error in the PDF version of the article. Figure 2b was erroneously missing content. The incorrect Fig. 2 is as follows: The correct Fig. 2 is as follows: The original article [1] has been corrected. Yin M, Song X, He C, et al. The haplotype-resolved

Spatial transcriptomics allows gene expression to be measured within complex tissue contexts. Among the array of spatial capture technologies available is 10x Genomics’ Visium platform, a popular method which enables transcriptome-wide profiling of tissue sections. Visium offers a range of sample handling and library construction methods which introduces a need for benchmarking to compare data quality

Nanopore direct RNA sequencing (DRS) is a powerful tool for RNA biology but suffers from low basecalling accuracy, low throughput, and high input requirements. We present DEMINERS, a novel DRS toolkit combining an RNA multiplexing workflow, a Random Forest-based barcode classifier, and an optimized convolutional neural network basecaller with species-specific training. DEMINERS enables accurate demultiplexing

Regulation of the target DNA cleavage activity of CRISPR/Cas has naturally evolved in a few bacteria or bacteriophages but is lacking in higher species. Thus, identification of bioactive agents and mechanisms that can suppress the activity of Cas9 is urgently needed to rebalance this new genetic pressure. Here, we identify four specific inhibitors of Cas9 by screening 4607 compounds that could inhibit

Sex-biased gene regulation is the basis of sexual dimorphism in phenotypes and has been studied across different cell types and different developmental stages. However, sex-biased expression of transposable elements (TEs), which represent nearly half of the mammalian genome and have the potential of influencing genome integrity and regulation, remains underexplored. We report a survey of gene, lncRNA

Snakes exhibit a broad variety of adaptive colors and color patterns, generated by the spatial arrangement of chromatophores, but little is known of the mechanisms responsible for these spectacular traits. Here, we investigate a mono-locus trait with two recessive alleles, motley and stripe, that both cause pattern aberrations in the corn snake. We use mapping-by-sequencing to identify the genomic

Transposable elements (TEs) can influence human diseases by disrupting genome integrity, yet their quantification has been challenging due to the repetitive nature of these sequences across the genome. We develop LocusMasterTE, a method that integrates long-read with short-read RNA-seq to increase the accuracy of TE expression quantification. By incorporating fractional transcript per million values

Correction: Genome Biol 24, 89 (2023) https://doi.org/10.1186/s13059-023–02928-7 Following publication of the original article [1], the authors identified an error in one of the guide RNA spacer sequences disclosed in Supplementary Table S3. The correct sequence for base editing mediated silencing of the CIITA is 5’−3’: CACTCACCTTAGCCTGAGCA, as originally described in Gaudelli et al. 2020 [2]. This

Mitochondrial DNA (mtDNA) variants hold promise as endogenous barcodes for tracking human cell lineages, but their efficacy as reliable lineage markers are hindered by the complex dynamics of mtDNA in somatic tissues. Here, we use computational modeling and single-cell genomics to thoroughly interrogate the origin and clonal dynamics of mtDNA variants across various biological settings. Our findings

How reversible glycosylation of DNA-bound proteins acts on transcription remains scarcely understood. O-linked β-N-acetylglucosamine (O-GlcNAc) is the only known form of glycosylation modifying nuclear proteins, including RNA polymerase II (RNA Pol II) and many transcription factors. Yet, the regulatory function of the O-GlcNAc modification in mammalian chromatin remains unclear. Here, we combine genome-wide

Fork-head box protein M1 (FOXM1) plays critical roles in development and progression of multiple cancers, including hepatocellular carcinoma (HCC). However, the exact regulatory hierarchy of FOXM1 remains unclear. Here, a genome-wide screen is performed to identify intranuclear proteins that promote FOXM1 transcription activity via liquid–liquid phase separation (LLPS). Abnormal spindle-like microcephaly

Lettuce is a globally important leafy vegetable that exhibits diverse horticultural types and strong population structure, which complicates genetic analyses. To address this challenge, we develop the first multi-parent, advanced generation inter-cross (MAGIC) population for lettuce using 16 diverse founder lines. Whole-genome sequencing of the 16 founder lines and 381 inbred progeny reveal minimal

A primary goal of microbial genome-wide association studies is identifying genomic variants associated with a particular habitat. Existing tools fail to identify known causal variants if the analyzed trait shaped the phylogeny. Furthermore, due to inclusion of allochthonous strains or metadata errors, the stated sources of strains in public databases are often incorrect, and strains may not be adapted

Alternative splicing of precursor mRNAs serves as a crucial mechanism to enhance gene expression plasticity for organismal adaptation. However, the precise regulation and function of alternative splicing in plant immune gene regulation remain elusive. Here, by deploying in-depth transcriptome profiling with deep genome coverage coupled with differential expression, differential alternative splicing

Discovering a lower-dimensional embedding of single-cell data can improve downstream analysis. The embedding should encapsulate both the high-level features and low-level variations. While existing generative models attempt to learn such low-dimensional representations, they have limitations. Here, we introduce scVAEDer, a scalable deep-learning model that combines the power of variational autoencoders

The Drosophila genus is ideal for studying genome evolution due to its relatively simple chromosome structure and small genome size, with rearrangements mainly restricted to within chromosome arms, such as Muller elements. However, work on the rapidly evolving repetitive genomic regions, composed of transposons and tandem repeats, have been hampered by the lack of genus-wide chromosome-level assemblies

A comprehensive study of the genome and genetics of superior germplasms is fundamental for crop improvement. As a widely adapted protein crop with high yield potential, the improvement in breeding and development of the seeds industry of faba bean have been greatly hindered by its giant genome size and high outcrossing rate. To fully explore the genomic diversity and genetic basis of important agronomic

Loose-skin mandarins (LSMs) are among the oldest domesticated horticultural crops, yet their domestication history and the genetic basis underlying the formation of key selected traits remain unclear. We provide a chromosome-scale and haplotype-resolved assembly for the ancient Chinese citrus variety Nanfengmiju tangerine. Through the integration of 77 resequenced and 114 published citrus germplasm

Transposable element (TE) expansion has long been known to mediate genome evolution and phenotypic diversity in organisms, but its impact on the evolution of post-transcriptional regulation following species divergence remains unclear. To address this issue, we perform long-read direct RNA sequencing, polysome profiling sequencing, and small RNA sequencing in the cotton genus Gossypium, the species

Dyslipidemia or hypercholesterolemia are among the main risk factors for cardiovascular diseases. Unraveling the molecular basis of lipid or cholesterol homeostasis would help to identify novel drug targets and develop effective therapeutics. Here, we adopt a systematic approach to catalog the genes underlying lipid and cholesterol homeostasis by combinatorial use of high-throughput CRISPR screening

Differential expression analysis is pivotal in single-cell transcriptomics for unraveling cell-type–specific responses to stimuli. While numerous methods are available to identify differentially expressed genes in single-cell data, recent evaluations of both single-cell–specific methods and methods adapted from bulk studies have revealed significant shortcomings in performance. In this paper, we dissect

Computational methods for spatially resolved transcriptomics (SRT) are often developed and assessed using simulated data. The effectiveness of these evaluations relies on the ability of simulation methods to accurately reflect experimental data. However, a systematic evaluation framework for spatial simulators is currently lacking. Here, we present SpatialSimBench, a comprehensive evaluation framework

The molecular underpinnings of organ dysfunction in severe COVID-19 and its potential long-term sequelae are under intense investigation. To shed light on these in the context of liver function, we perform single-nucleus RNA-seq and spatial transcriptomic profiling of livers from 17 COVID-19 decedents. We identify hepatocytes positive for SARS-CoV-2 RNA with an expression phenotype resembling infected

Metabolomics is one of the most widely used omics tools for deciphering the functional networks of the metabolites for crop improvement. However, it is technically demanding and costly. We propose a relatively inexpensive approach for metabolomics analysis in which metabolomics is combined with hyperspectral imaging via machine learning. This approach can be used to target important steps in flavonoid

N6-methyladenosine (m6A) is a prevalent and conserved RNA modification in eukaryotes. While its roles in the 3’ untranslated regions (3’ UTR) are well-studied, its role in the 5' UTR and its relationship with histone modifications remain underexplored. We demonstrate that m6A methylation in the 5’ UTR of mRNA triggers a downstream shift in H3K4me3 modification. This regulatory mechanism is conserved

Chromosomal rearrangements, such as translocations, deletions, and inversions, underlie numerous genetic diseases and cancers, yet precise engineering of these rearrangements remains challenging. Here, we present a CRISPR-based homologous recombination-mediated rearrangement (HRMR) strategy that leverages homologous donor templates to align and repair broken chromosome ends. HRMR improves efficiency

Single-cell RNA sequencing (scRNA-seq) data from complex human tissues have prevalent blood cell contamination during the sample preparation process. They may also comprise cells of different genetic makeups. We propose a new computational framework, Originator, which deciphers single cells by genetic origin and separates immune cells of blood contamination from those of expected tissue-resident cells

Identifying transcriptional cis-regulatory elements (CREs) and understanding their role in gene expression are essential for the precise manipulation of gene expression and associated phenotypes. This knowledge is fundamental for advancing genetic engineering and improving crop traits. We here demonstrate that CREs can be accurately predicted and utilized to precisely regulate gene expression beyond

Genome-wide association studies (GWAS) have identified common variants associated with metabolic dysfunction-associated steatotic liver disease (MASLD). However, rare coding variant studies have been limited by phenotyping challenges and small sample sizes. We test associations of rare and ultra-rare coding variants with proton density fat fraction (PDFF) and MASLD case–control status in 736,010 participants

Cell-free DNA (cfDNA) is a rich source of biomarkers for various pathophysiological conditions. Preanalytical variables, such as the library preparation protocol or sequencing platform, are major confounders of cfDNA analysis. We present DAGIP, a novel data correction method that builds on optimal transport theory and deep learning, which explicitly corrects for the effect of such preanalytical variables

Mobilization of transposable elements (TEs) can generate large effect mutations. However, due to the difficulty of detecting new TE insertions in genomes and the typically rare occurrence of transposition, the actual rate, distribution, and population dynamics of new insertions remain largely unexplored. We present a TE display sequencing approach that leverages target amplification of TE extremities

B chromosomes contribute to the genetic variation in numerous eukaryotes. Yet their genetic and epigenetic characteristics, as well as their effects on the host genome remain poorly understood. Here, we present a comprehensive genome assembly of diploid maize B73 with two copies of B chromosomes using long-read sequencing. We annotate a total of 1124 high-confidence protein-coding genes and 119,579

Recent advances in single-cell multimodal omics sequencing have facilitated the simultaneous profiling of transcriptomes and surface proteomes within individual cells, offering insights into cellular functions and heterogeneity. However, the high costs and technical complexity of protocols like CITE-seq and REAP-seq constrain large-scale dataset generation. To overcome this limitation, surface protein

Eukaryotic cells are highly structured and composed of multiple membrane-bound and membraneless organelles. Subcellular RNA localization is a critical regulator of RNA function, influencing various biological processes. At any given moment, RNAs must accurately navigate the three-dimensional subcellular environment to ensure proper localization and function, governed by numerous factors, including

CTCF is considered as the most essential transcription factor regulating chromatin architecture and gene expression. However, genome-wide impact of CTCF on erythropoiesis has not been extensively investigated. Using a state-of-the-art human erythroid progenitor cell model (HUDEP-2 and HEL cell lines), we systematically investigate the effects of acute CTCF loss by an auxin-inducible degron system on

The northern European Neolithic is characterized by two major demographic events: immigration of early farmers from Anatolia at 7500 years before present, and their admixture with local western hunter-gatherers forming late farmers, from around 6200 years before present. The influence of this admixture event on variation in the immune-relevant human leukocyte antigen (HLA) region is understudied. We

Gene context-essentiality assessment supports precision oncology opportunities. The variability of gene effects inference from loss-of-function screenings across models and technologies limits identifying robust hits. We propose a computational framework named PRODE that integrates gene effects with protein–protein interactions to generate neighborhood-informed essential (NIE) and neighborhood-informed

We present GuideScan2 for memory-efficient, parallelizable construction of high-specificity CRISPR guide RNA (gRNA) databases and user-friendly design and analysis of individual gRNAs and gRNA libraries for targeting coding and non-coding regions in custom genomes. GuideScan2 analysis identifies widespread confounding effects of low-specificity gRNAs in published CRISPR screens and enables construction