Next Article in Journal
Acupuncture on ST36, CV4 and KI1 Suppresses the Progression of Methionine- and Choline-Deficient Diet-Induced Nonalcoholic Fatty Liver Disease in Mice
Next Article in Special Issue
The Key Role of Purine Metabolism in the Folate-Dependent Phenotype of Autism Spectrum Disorders: An In Silico Analysis
Previous Article in Journal
Short-Term Temporal Metabolic Behavior in Halophilic Cyanobacterium Synechococcus sp. Strain PCC 7002 after Salt Shock
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Metabolites
Volume 9
Issue 12
10.3390/metabo9120298
metabolites-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Plasma Homocysteine and Polymorphisms of Genes Involved in Folate Metabolism Correlate with DNMT1 Gene Methylation Levels

by
Fabio Coppedè
*,
Andrea Stoccoro
,
Pierpaola Tannorella
† and
Lucia Migliore
Department of Translational Research and of New Surgical and Medical Technologies, University of Pisa, Via Roma 55, 56126 Pisa, Italy
*
Author to whom correspondence should be addressed.
†
Current address: Unit of Genetics of Neurodegenerative and Metabolic Diseases, Fondazione IRCCS Istituto Neurologico Carlo Besta, 20133 Milan, Italy.
Metabolites 2019, 9(12), 298; https://doi.org/10.3390/metabo9120298
Submission received: 21 October 2019 / Revised: 1 December 2019 / Accepted: 5 December 2019 / Published: 7 December 2019
(This article belongs to the Special Issue Folate Absorption and Metabolism)
Browse Figures
Versions Notes

Abstract

:
DNA methyltransferase 1 (DNMT1) is responsible for the maintenance of DNA methylation patterns during cell division. Several human diseases are characterized by impaired DNMT1 gene methylation, but less is known about the factors that regulate DNMT1 promoter methylation levels. Dietary folates and related B-vitamins are essential micronutrients for DNA methylation processes, and we performed the present study to investigate the contribution of circulating folate, vitamin B12, homocysteine, and common polymorphisms in folate pathway genes to the DNMT1 gene methylation levels. We investigated DNMT1 gene methylation levels in peripheral blood DNA samples from 215 healthy individuals. All the DNA samples were genotyped for MTHFR 677C > T (rs1801133) and 1298A > C (rs1801131), MTRR 66A > G (rs1801394), MTR 2756A > G (rs1805087), SLC19A1 (RFC1) 80G > A (rs1051266), TYMS 28-bp tandem repeats (rs34743033) and 1494 6-bp insertion/deletion (indel) (rs34489327), DNMT3A -448A > G (rs1550117), and DNMT3B -149C > T (rs2424913) polymorphisms. Circulating homocysteine, folate, and vitamin B12 levels were available from 158 of the recruited individuals. We observed an inverse correlation between plasma homocysteine and DNMT1 methylation levels. Furthermore, both MTR rs1805087 and TYMS rs34743033 polymorphisms showed a statistically significant effect on DNMT1 methylation levels. The present study revealed several correlations between the folate metabolic pathway and DNMT1 promoter methylation that could be of relevance for those disorders characterized by altered DNA methylation.

1. Introduction

DNA methylation is one of the most investigated epigenetic mechanisms that tightly regulate gene transcription and expression levels, and it consists of the addition of a methyl group to the DNA, mediated by a class of enzymes called DNA methyltransferases (DNMTs) [1]. DNA methylation usually occurs on cytosine, forming 5-methylcytosine (5-mC) in a cytosine–phosphate–guanine (CpG) dinucleotide context, and CpG methylation in the promoter region of a gene represses gene expression [2]. The human genome encodes five DNMTs, namely, DNMT1, DNMT2, DNMT3A, DNMT3B, and DNMTL [3]. Among them, DNMT1 is the “maintenance” DNMT that maintains DNA methylation patterns during cell division, while DNMT3A and DNMT3B are responsible for the establishment of de novo DNA methylation patterns during embryogenesis. DNMT3L is not an active DNMT, but an important cofactor for DNMT3 enzymatic activity, whilst DNMT2 is likely an ancient DNMT that switched its substrate from DNA to RNA [3]. Micronutrients such as folate, vitamin B12, and other B-group vitamins contribute to DNA methylation as methyl donors and cofactors (Figure 1), and the status of these nutrients correlates with both global and gene-specific methylation levels [4]. The “core” parts of one-carbon metabolism are the folate and methionine cycles, a set of interconnected pathways required for the synthesis of S-adenosylmethionine (SAM), the main intracellular methylating agent. Indeed, DNMTs catalyze the transfer of the methyl group from SAM to the DNA (Figure 1).
As discussed above, DNMT1 is the main enzyme responsible for the maintenance of DNA methylation during cell division, and previous studies revealed the existence of a CpG island in the promoter/5′ untranslated region (5′UTR) of the DNMT1 gene itself, whose methylation levels regulate DNMT1 gene expression in both healthy and pathological tissues [5,6,7,8,9,10,11,12]. In this regard, increased DNMT1 promoter methylation resulting in decreased gene expression levels was observed in blood DNA of individuals with ankylosing spondylitis, a chronic inflammatory autoimmune disease [5]. Similarly, a decreased DNMT1 expression was observed in blood DNA of individuals with Kawasaki disease, an acute vasculitis syndrome [6], whilst increased DNMT1 expression was observed in blood DNA from patients with psoriasis [7]. Changes in DNMT1 promoter methylation were also observed in peripheral blood DNA samples from patients with acute lymphoblastic leukemia (ALL) and were linked to the DNMT1 expression pattern in the patients [8]. Furthermore, DNMT1 expression levels in white blood cells of healthy individuals showed a large inter-individual variability [9]. Hypermethylation of the Dnmt1 promoter was also responsible for reduced gene expression levels in various tissues of animal models of asthma [10]. The investigation of DNMT1 methylation, expression, and protein levels in solid tumors showed a large variability according to the investigated cell line or to the cancer subtype [9,11,12,13].
Little is still known concerning genetic, dietary, or environmental factors linked to changes in DNMT1 methylation levels. In this regard, a previous investigation in peripheral blood DNA samples of Alzheimer’s disease (AD) individuals suggested that the promoter methylation levels of several genes, including DNMT1, could be linked to circulating markers of folate metabolism, and particularly to plasma homocysteine (Hcy) levels [14].
The present study was performed to better address the contribution of folate metabolism to DNMT1 gene methylation levels. We collected blood samples from 215 healthy individuals, investigated DNMT1 methylation levels in the extracted DNA, and searched for correlation between DNMT1 promoter methylation levels and circulating folate, Hcy, or vitamin B12 levels. In addition, the major polymorphisms on folate-pathway genes, such as methylenetetrahydrofolate reductase (MTHFR) 677C > T (rs1801133) and 1298A > C (rs1801131), methionine synthase (MTR) 2756A > G (rs1805087), methionine synthase reductase (MTRR) 66A > G (rs1801394), thymidilate synthase (TYMS) 28-bp tandem repeat (rs34743033) and 1494 insertion/deletion (indel) (rs34489327), and reduced folate carrier (SLC19A1 or RFC1) 80A > G (rs1051266), as well as both DNMT3A -448A > G (rs1550117) and DNMT3B -149C > T (rs2424913) polymorphisms, are often linked to changes in DNA methylation levels [15,16,17,18,19]. Therefore, we also investigated the contribution of these major polymorphisms of genes involved in the folate pathway to DNMT1 promoter methylation levels.

2. Results

2.1. Distribution of the Investigated Variables in the Study Population

The demographic characteristics of the study population and the average methylation levels of the DNMT1 gene are shown in Table 1. In total, 215 healthy Italian subjects, including 85 males and 130 females of mean age 76.4 years, composed the study cohort. Plasma Hcy, serum folate, and vitamin B12 levels were available from 158 individuals, and their average values are shown in Table 1.
The promoter methylation levels of the DNMT1 gene ranged from 0% to 15% in the study population (Figure 2), with an average value of 2.2% (Table 1), which is in agreement with previous investigations in other cohorts [14,20,21].
The genotype distribution of the investigated polymorphisms is shown in Table 2. Genotype frequencies are in agreement with those previously observed in healthy Caucasians [19,22], and conformed to Hardy–Weinberg equilibrium (HWE) expectations (p > 0.05).

2.2. Correlation between DNMT1 Methylation and Biochemical Variables

Figure 3 shows the correlation between DNMT1 promoter methylation and circulating folate, Hcy, and vitamin B12 levels. A significant inverse correlation between DNMT1 promoter methylation and plasma Hcy levels was observed (r = −0.23, p = 0.008). No correlation was observed between DNMT1 promoter methylation and serum folate levels (r = 0.01, p = 0.85), whilst a trend for correlation with serum vitamin B12 was observed, although not statistically significant (r = 0.11, p = 0.19).

2.3. Gender and Age Effect on DNMT1 Methylation Levels and Biochemical Variables

Figure 4 shows the contribution of gender to circulating folate, Hcy, and vitamin B12 levels, as well as to the methylation levels of the DNMT1 gene. We observed significantly higher Hcy levels in males than in females (p = 0.002), whilst vitamin B12 levels were higher in females with respect to males (p = 0.02), and a similar trend was observed for folates, even if the gender difference was not statistically significant (p = 0.11). No gender difference was observed for DNMT1 methylation levels (p = 0.97) (Figure 4).
The contribution of age to the studied variables is shown in Figure 5. A positive correlation was observed between Hcy levels and age (r = 0.37, p < 0.0001). No significant correlation was observed between age and the other variables (folate, vitamin B12, and DNMT1 methylation levels).

2.4. DNMT1 Methylation Levels and Polymorphisms of the Folate Pathway Genes

Analysis of variance (ANOVA) in the whole cohort of subjects revealed a statistically significant contribution of both the MTR 2756A > G and the TYMS 28-bp repeat polymorphisms to DNMT1 promoter methylation levels. In particular, a significant increase in DNMT1 methylation levels was observed in carriers of the MTR mutant allele (AG + GG) with respect to wild-type (AA) subjects (p = 0.01), and the TYMS 28-bp repeat polymorphism had a significant effect on DNMT1 methylation levels in our cohort, with carriers of the 3R/3R genotype showing significantly higher methylation levels than 2R/2R carriers (p = 0.03). None of the other polymorphisms showed a significant contribution to DNMT1 methylation levels (Figure 6). Overlapping results were observed in the subgroup of 158 subjects with available data on folate, Hcy, and vitamin B12 levels (not shown).

3. Discussion

In the present study, we investigated the contribution of circulating folate, Hcy, and vitamin B12, as well as of major polymorphisms of the folate pathway genes, as modulators of DNMT1 promoter methylation levels in blood DNA from healthy individuals, observing an inter-individual variability in DNMT1 promoter methylation levels, which ranged from 0% to 15% in the studied cohort, a significant inverse correlation with plasma Hcy levels, and a trend for a positive correlation with vitamin B12 levels. Furthermore, carriers of the MTR 2756G allele (AG + GG) showed a significantly higher DNMT1 promoter methylation than non-carriers (AA), as well as carriers of the TYMS 28-bp repeat 3R/3R genotype with respect to 2R/2R carriers. None of the other investigated polymorphisms were linked to the methylation status of the DNMT1 promoter. Age and gender had no significant effect on DNMT1 promoter methylation levels in our cohort.
Present data confirm previous investigations of the methylation status of the DNMT1 promoter in blood DNA samples, all reporting low methylation levels in average, albeit with inter-individual variability [14,20,21]. Furthermore, we confirmed previous findings obtained in a cohort of 100 Alzheimer’s disease individuals and matched controls, showing that elevated plasma Hcy levels in the AD subjects were linked to reduced methylation levels of several genes in blood DNA, including DNMT1 [14]. Homocysteine is a metabolite for methionine production, and methionine is the precursor of SAM that serves as the universal one-carbon donor for DNA methylation reactions (Figure 1), such that hyperhomocysteinemia (HHcy) is often linked to reduced DNA methylation potential [23], and the epigenetic dysregulation of gene expression is a pathogenic consequence of HHcy in many human diseases [24]. In this context, previous in vitro studies revealed that Hcy treatment altered the expression levels of DNMT1, leading to global or gene-specific DNA methylation changes [25,26,27]. For example, Hcy treatment enhanced DNMT1 expression in oocytes leading to hypermethylation of the mitochondrial DNA [25], upregulated DNMT1 expression leading to DNA hypermethylation of the mitofusin 2 gene promoter in vascular smooth muscle cells [26], or induced DNA hypomethylation of the cyclin A promoter in endothelial progenitor cells through downregulated expression of DNMT1 [27]. A mechanistic link between Hcy and DNA methylation is the resulting reduction of the S-adenosylmethionine/S-adenosylhomocysteine ratio following HHcy, and the subsequent accumulation of S-adenosylhomocysteine, which in turn inhibits methyl transfer reactions; however, it was also suggested that Hcy can alter the binding of transcription factors to the DNMT1 promoter [25,26,27]. The present study suggests that Hcy levels correlate with DNMT1 promoter methylation levels, thus strengthening the contribution of this metabolite to the regulation of DNA methylation.
Original findings of the present study are the correlations between DNMT1 promoter methylation levels and both MTR 2756A > G and TYMS 28-bp repeat polymorphisms. Particularly, we observed increased DNMT1 methylation levels in carriers of the MTR 2756G allele compared to the wild-type MTR 2756AA genotype. The MTR gene encodes for methionine synthase, the enzyme that catalyzes the remethylation of Hcy to methionine, and cobalamin (vitamin B12) is a cofactor in this reaction (Figure 1). The MTR 2756A > G polymorphism impairs MTR function and stability [28,29] and is often linked to either global or gene-specific DNA methylation changes in human cells and tissues [18,30,31,32,33]. For example, the MTR 2756A > G polymorphism was linked to increased global DNA methylation levels in human leukocytes [30], and carriers of the variant G allele had a significant increase of LINE-1 (long interspersed nuclear element 1) methylation in histologically normal breast tissues, compared to those carrying the common AA genotype [18]. Other studies reported association of this polymorphism with global methylation levels of leukocyte DNA [31], with MTHFR methylation levels in blood DNA of valproate-treated patients with epilepsy [32], and with hypermethylation of tumor suppressor genes in cancer specimens [33] or adjacent healthy tissues [17]. The present finding of a correlation between the MTR 2756A > G polymorphism and DNMT1 promoter methylation levels in blood DNA not only strengthens the contribution of this genetic variant to the DNA methylation levels in leukocytes, but it could also be of relevance for those disorders, such as hematological malignancies, autoimmune/inflammatory disorders, and solid tumors, that are linked to impaired DNMT1 methylation and/or expression [5,6,7,8,9,10,11,12]. For example, changes in DNMT1 methylation levels were observed in peripheral blood DNA samples from ALL patients [8], the MTR 2756A > G polymorphism was linked to the risk of pediatric ALL [34], and several maternal polymorphisms of the MTR gene were recently proposed as responsible of aberrant methylation of ALL-related genes in their offspring [35]. Furthermore, the MTR 2756A > G polymorphism was also linked to the risk of autoimmune/inflammatory diseases and solid tumors, all characterized by impaired DNMT activities and global and gene-specific DNA methylation changes [36,37,38,39], suggesting that the investigation of the contribution of this polymorphism to DNMT1 methylation levels is warranted in all these disorders.
TYMS and MTHFR compete for 5,10-methylenetetrahydrofolate in such a way that the folate pathway can be shifted from DNA methylation to the synthesis of DNA precursors, based on cellular demands (Figure 1). In this regard, the 28-bp tandem repeat polymorphism, located in the 5′UTR of the TYMS gene, works as enhancer for TYMS transcription, with higher efficiency conferred by the 3R allele with respect to the 2R one. This enhanced expression minimizes uracil misincorporation into the DNA and increases the availability of DNA precursors, such that this polymorphism is often associated with cellular growth and risk of human malignancies, including leukemias, lymphomas, breast cancer, and thoracic neoplasms, among others [40,41,42,43]. Less is known about the contribution of TYMS polymorphisms to the DNA methylation levels, even if the TYMS 28-bp tandem repeat polymorphism was associated with gene-specific methylation levels in the blood DNA of patients systemic lupus erythematosus [44], and other TYMS polymorphisms were linked to either global or gene-specific methylation levels in both healthy and cancerous tissues, reinforcing the evidence that DNA synthesis and methylation are interconnected pathways [17,45,46,47]. The present findings of a correlation between the TYMS 28-bp tandem repeat polymorphism and DNMT1 promoter methylation levels in blood cells highlight the contribution of this gene to DNA methylation, and suggest that further investigation is warranted in human disorders associated to this variant.
The main limitation of the present study was that we investigated an elderly population of limited sample size that, despite healthy at collection, could include individuals with age-related subclinical conditions potentially impacting the findings. Therefore, results should be considered preliminary, and replication in a larger cohort and in younger subjects is warranted. Moreover, the observed DNMT1 methylation levels were low on average, and their inter-individual variability could result from subclones of cells with high levels of DNMT1 methylation in some individuals. Further investigations of single-cell DNA methylation levels are warranted to clarify this issue and their potential correlation with preclinical conditions in humans.
In conclusion, we investigated the contribution of both metabolites and genetic polymorphisms in the folate metabolic pathway to the DNMT1 promoter methylation levels in blood DNA from healthy individuals, observing an inverse correlation with plasma Hcy levels, and significant associations for both MTR 2756A > G and TYMS 28-bp tandem repeat polymorphisms. The present study highlights the links existing between the folate metabolic pathway and the promoter methylation levels of the maintenance DNMT, suggesting that further studies are required to address this issue in human disorders characterized by changes in DNMT1 promoter methylation, such as hematological malignancies, solid tumors, and autoimmune/inflammatory diseases.

4. Materials and Methods

4.1. Study Population

We collected peripheral blood samples from 215 healthy individuals, including 85 males and 130 females of mean age 76.4 ± 9.6 years (Table 1). All individuals were volunteer subjects of Italian origin, underwent a rigorous clinical and neurological examination before inclusion in the study, and were healthy at blood drawing. In addition, individuals taking drugs, substances, or vitamin supplements known or suspected to interfere with DNA methylation, such as anti-cancer drugs, anti-epileptic drugs, anti-inflammatory drugs, epi-drugs, metformin, tobacco smoking, folic acid, or other vitamins, were not enrolled in the study. Written informed consent for inclusion in the study was collected from each subject. The study was conducted in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of the Pisa University Hospital (Protocol number 3618/2012).

4.2. Collection of DNA Samples

Genomic DNA was extracted from peripheral blood samples using the QIAamp® Blood Mini Kit (Catalog No. 51104, Qiagen, Milan, Italy) following the manufacturer’s instructions. DNA samples were stored at −20 °C until assayed.

4.3. Biochemical Analyses

The measurement of plasma Hcy, serum vitamin B12, and folate levels was performed with the standard diagnostic laboratory methodologies of the Pisa University Hospital, as detailed elsewhere [48].

4.4. Genotyping for Common Polymorphisms in Genes of the Folate Metabolic Pathway

PCR/RFLP techniques, detailed elsewhere [49,50], were applied for genotyping all the study polymorphisms, namely, MTHFR 677C > T (rs1801133) and 1298A > C (rs1801131), MTR 2756A > G (rs1805087), MTRR 66A > G (rs1801394), SLC19A1 (RFC-1) 80G > A (rs1051266), TYMS 28-bp repeats (rs34743033) and 1494 6-bp indel (rs34489327), DNMT3A −448A > G (rs1550117), and DNMT3B −149C > T (rs2424913).

4.5. Analysis of DNMT1 Methylation Levels

In total, 200 ng of DNA from each sample was quantified using a Nanodrop ND 2000c spectrophotometer (NanoDrop, Thermo Scientific, Wilmington, DE, USA). The DNA was subsequently treated with sodium bisulfite, using the EpiTect Bisulfite Kit (Catalog No. 59104, Qiagen, Milan, Italy), to convert unmethylated cytosines into uracil. All the samples were treated simultaneously in order to avoid potential batch effects. The bisulfite conversion efficiency, assessed using a sample of completely unmethylated human DNA (Catalog No. 59568, Qiagen, Milan, Italy), was 99% on average. For the analysis of DNMT1 methylation levels, we applied the methylation-sensitive high-resolution melting (MS-HRM) technique, using a protocol previously developed, validated, and fully described by us elsewhere [51]. All the analyses were performed in a CFX96 Real-Time PCR detection system (Bio-Rad, Milan, Italy). We investigated a CpG island in the promoter/5′UTR region of the DNMT1 gene, whose methylation levels were previously linked to DNMT1 gene expression levels [5,8]. Table 3 lists the sequence of the primers and the details of the investigated region. Each reaction was performed in duplicate, and 10% of the samples were analyzed independently on separate occasions to verify the inter-assay variability. The mean standard error for inter-assay variability was 0.1%, indicating a very good technical reproducibility. We mixed fully methylated and unmethylated DNA (EpiTectH methylated and unmethylated human control DNA, bisulfite-converted (Catalog No. 59695, Qiagen, Milan, Italy), to obtain the following ratios of methylation: 0%, 25%, 50%, 75%, and 100%. These standard DNA samples were included in each assay to generate standard curves (Figure 2) that were used to deduce the methylation levels of each sample, as detailed elsewhere [52].

4.6. Statistical Analyses

The chi-square (Χ2) analysis was used to investigate deviations from Hardy–Weinberg equilibrium. Linear regression analysis was used to investigate the correlation between DNMT1 promoter methylation levels and plasma Hcy, serum folate, or vitamin B12 levels. Similarly, linear regression was applied to investigate the correlation of these variables with age. Analysis of variance (ANOVA) was used to evaluate gender differences in DNMT1 promoter methylation levels and plasma Hcy, serum folate, or vitamin B12 levels. ANOVA, including age at sampling and gender as covariates (and also plasma Hcy, serum folate, and vitamin B12 levels in the subgroup of patients with available metabolites), was used to investigate the contribution of each of the studied polymorphisms to DNMT1 methylation levels, followed by post hoc Bonferroni’s correction for multiple testing. The Shapiro–Wilk test was used to check for normality, and natural logarithm transformation of data that did not follow a normal distribution (DNMT1 methylation levels, plasma Hcy, serum folate, and vitamin B12) was done before the analyses. Statistical analyses were performed with the STATGRAPHICS 5.1 plus software package for Windows and the MedCalc statistical software v. 12.5. We considered Bonferroni’s corrected p-values < 0.05 as statistically significant.

Author Contributions

Conceptualization, F.C.; methodology, P.T. and A.S.; validation, P.T.; formal analysis, F.C. and A.S.; investigation, P.T., A.S., and F.C.; resources, F.C. and L.M.; data curation, A.S. and P.T.; writing—original draft preparation, F.C.; writing—review and editing, F.C. and L.M.; visualization, F.C.; supervision, F.C.; project administration, F.C.; funding acquisition, F.C.

Funding

This research was funded by the Italian Ministry of Health, grant number GR-2009-1606229 (F.C., principal investigator).

Acknowledgments

The authors acknowledge all the volunteer subjects that participated to this study and the medical personnel of the Pisa University Hospital that performed the clinical evaluation.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Morgan, A.E.; Davies, T.J.; Mc Auley, M.T. The role of DNA methylation in ageing and cancer. Proc. Nutr. Soc. 2018, 77, 412–422. [Google Scholar] [CrossRef]
  2. Moore, L.D.; Le, T.; Fan, G. DNA methylation and its basic function. Neuropsychopharmacology 2013, 38, 23–38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Lyko, F. The DNA methyltransferase family: A versatile toolkit for epigenetic regulation. Nat. Rev. Genet. 2018, 19, 81–92. [Google Scholar] [CrossRef] [PubMed]
  4. Coppedè, F. The genetics of folate metabolism and maternal risk of birth of a child with Down syndrome and associated congenital heart defects. Front. Genet. 2015, 6, 223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Aslani, S.; Mahmoudi, M.; Garshasbi, M.; Jamshidi, A.R.; Karami, J.; Nicknam, M.H. Evaluation of DNMT1 gene expression profile and methylation of its promoter region in patients with ankylosing spondylitis. Clin. Rheumatol. 2016, 35, 2723–2731. [Google Scholar] [CrossRef] [PubMed]
  6. Huang, Y.H.; Chen, K.D.; Lo, M.H.; Cai, X.Y.; Chang, L.S.; Kuo, Y.H.; Huang, W.D.; Kuo, H.C. Decreased DNA methyltransferases expression is associated with coronary artery lesion formation in Kawasaki disease. Int. J. Med. Sci. 2019, 16, 576–582. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Zhang, P.; Su, Y.; Chen, H.; Zhao, M.; Lu, Q. Abnormal DNA methylation in skin lesions and PBMCs of patients with psoriasis vulgaris. J. Dermatol. Sci. 2010, 60, 40–42. [Google Scholar] [CrossRef] [PubMed]
  8. Rahmani, T.; Azad, M.; Chahardouli, B.; Nasiri, H.; Vatanmakanian, M.; Kaviani, S. Patterns of DNMT1 Promoter Methylation in Patients with Acute Lymphoblastic Leukemia. Int. J. Hematol. Oncol. Stem Cell Res. 2017, 11, 172–177. [Google Scholar]
  9. Honeywell, R.J.; Sarkisjan, D.; Kristensen, M.H.; de Klerk, D.J.; Peters, G.J. DNA methyltransferases expression in normal tissues and various human cancer cell lines, xenografts and tumors. Nucleosides Nucleotides Nucleic Acids 2018, 37, 696–708. [Google Scholar] [CrossRef] [Green Version]
  10. Verma, M.; Chattopadhyay, B.D.; Paul, B.N. Epigenetic regulation of DNMT1 gene in mouse model of asthma disease. Mol. Biol. Rep. 2013, 40, 2357–2368. [Google Scholar] [CrossRef]
  11. Zhang, W.; Xu, J. DNA methyltransferases and their roles in tumorigenesis. Biomark. Res. 2017, 5, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Shin, E.; Lee, Y.; Koo, J.S. Differential expression of the epigenetic methylation-related protein DNMT1 by breast cancer molecular subtype and stromal histology. J. Transl. Med. 2016, 14, 87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Jahangiri, R.; Mosaffa, F.; Emami Razavi, A.; Teimoori-Toolabi, L.; Jamialahmadi, K. Altered DNA methyltransferases promoter methylation and mRNA expression are associated with tamoxifen response in breast tumors. J. Cell. Physiol. 2018, 233, 7305–7319. [Google Scholar] [CrossRef] [PubMed]
  14. Grossi, E.; Stoccoro, A.; Tannorella, P.; Migliore, L.; Coppedè, F. Artificial Neural Networks Link One-Carbon Metabolism to Gene-Promoter Methylation in Alzheimer’s Disease. J. Alzheimers Dis. 2016, 53, 1517–1522. [Google Scholar] [CrossRef] [Green Version]
  15. McKay, J.A.; Groom, A.; Potter, C.; Coneyworth, L.J.; Ford, D.; Mathers, J.C.; Relton, C.L. Genetic and non-genetic influences during pregnancy on infant global and site specific DNA methylation: Role for folate gene variants and vitamin B12. PLoS ONE 2012, 7, e33290. [Google Scholar] [CrossRef]
  16. Haggarty, P.; Hoad, G.; Horgan, G.W.; Campbell, D.M. DNA methyltransferase candidate polymorphisms; imprinting methylation, and birth outcome. PLoS ONE 2013, 8, e68896. [Google Scholar] [CrossRef] [Green Version]
  17. Coppedè, F.; Migheli, F.; Lopomo, A.; Failli, A.; Legitimo, A.; Consolini, R.; Fontanini, G.; Sensi, E.; Servadio, A.; Seccia, M.; et al. Gene promoter methylation in colorectal cancer and healthy adjacent mucosa specimens: Correlation with physiological and pathological characteristics, and with biomarkers of one-carbon metabolism. Epigenetics 2014, 9, 621–633. [Google Scholar] [CrossRef] [Green Version]
  18. Llanos, A.A.; Marian, C.; Brasky, T.M.; Dumitrescu, R.G.; Liu, Z.; Mason, J.B.; Makambi, K.H.; Spear, S.L.; Kallakury, B.V.; Freudenheim, J.L.; et al. Associations between genetic variation in one-carbon metabolism and LINE-1 DNA methylation in histologically normal breast tissues. Epigenetics 2015, 10, 727–735. [Google Scholar] [CrossRef]
  19. Coppedè, F.; Stoccoro, A.; Tannorella, P.; Gallo, R.; Nicolì, V.; Migliore, L. Association of Polymorphisms in Genes Involved in One-Carbon Metabolism with MTHFR Methylation Levels. Int. J. Mol. Sci. 2019, 20, 3754. [Google Scholar] [CrossRef] [Green Version]
  20. Wang, S.C.; Oelze, B.; Schumacher, A. Age-specific epigenetic drift in late-onset Alzheimer’s disease. PLoS ONE 2008, 3, e2698. [Google Scholar] [CrossRef] [Green Version]
  21. Lopomo, A.; Ricciardi, R.; Maestri, M.; De Rosa, A.; Melfi, F.; Lucchi, M.; Mussi, A.; Coppedè, F.; Migliore, L. Gene-Specific Methylation Analysis in Thymomas of Patients with Myasthenia Gravis. Int. J. Mol. Sci. 2016, 17, 2121. [Google Scholar] [CrossRef] [Green Version]
  22. Angelini, S.; Ravegnini, G.; Nannini, M.; Bermejo, J.L.; Musti, M.; Pantaleo, M.A.; Fumagalli, E.; Venturoli, N.; Palassini, E.; Consolini, N.; et al. Folate-related polymorphisms in gastrointestinal stromal tumours: Susceptibility and correlation with tumour characteristics and clinical outcome. Eur. J. Hum. Genet. 2015, 23, 817–823. [Google Scholar] [CrossRef] [Green Version]
  23. Mandaviya, P.R.; Stolk, L.; Heil, S.G. Homocysteine and DNA methylation: A review of animal and human literature. Mol. Genet. Metab. 2014, 113, 243–252. [Google Scholar] [CrossRef]
  24. Perła-Kaján, J.; Jakubowski, H. Dysregulation of Epigenetic Mechanisms of Gene Expression in the Pathologies of Hyperhomocysteinemia. Int. J. Mol. Sci. 2019, 20, 3140. [Google Scholar] [CrossRef] [Green Version]
  25. Jia, L.; Zeng, Y.; Hu, Y.; Liu, J.; Yin, C.; Niu, Y.; Wang, C.; Li, J.; Jia, Y.; Hong, J.; et al. Homocysteine impairs porcine oocyte quality via deregulation of one-carbon metabolism and hypermethylation of mitochondrial DNA. Biol. Reprod. 2019, 100, 907–916. [Google Scholar] [CrossRef]
  26. Xu, L.; Hao, H.; Hao, Y.; Wei, G.; Li, G.; Ma, P.; Xu, L.; Ding, N.; Ma, S.; Chen, A.F.; et al. Aberrant MFN2 transcription facilitates homocysteine-induced VSMCs proliferation via the increased binding of c-Myc to DNMT1 in atherosclerosis. J. Cell. Mol. Med. 2019, 23, 4611–4626. [Google Scholar] [CrossRef]
  27. Zhang, H.P.; Wang, Y.H.; Ma, S.C.; Zhang, H.; Yang, A.N.; Yang, X.L.; Zhang, M.H.; Sun, J.M.; Hao, Y.J.; Jiang, Y.D. Homocysteine inhibits endothelial progenitor cells proliferation via DNMT1-mediated hypomethylation of Cyclin A. Exp. Cell. Res. 2018, 362, 217–226. [Google Scholar] [CrossRef]
  28. Ebrahimi, A.; Hosseinzadeh Colagar, A.; Karimian, M. Association of Human Methionine Synthase-A2756G Transition With Prostate Cancer: A Case-Control Study and in Silico Analysis. Acta Med. Iran. 2017, 55, 297–303. [Google Scholar]
  29. Karimian, M.; Hosseinzadeh Colagar, A. Methionine synthase A2756G transition might be a risk factor for male infertility: Evidences from seven case-control studies. Mol. Cell. Endocrinol. 2016, 425, 1–10. [Google Scholar] [CrossRef]
  30. Weiner, A.S.; Boyarskikh, U.A.; Voronina, E.N.; Mishukova, O.V.; Filipenko, M.L. Methylenetetrahydrofolate reductase C677T and methionine synthase A2756G polymorphisms influence on leukocyte genomic DNA methylation level. Gene 2014, 533, 168–172. [Google Scholar] [CrossRef]
  31. Bleich, S.; Semmler, A.; Frieling, H.; Thumfart, L.; Muschler, M.; Hillemacher, T.; Kornhuber, J.; Kallweit, U.; Simon, M.; Linnebank, M. Genetic variants of methionine metabolism and DNA methylation. Epigenomics 2014, 6, 585–591. [Google Scholar] [CrossRef] [Green Version]
  32. Ni, G.; Qin, J.; Chen, Z.; Li, H.; Zhou, J.; Huang, M.; Zhou, L. Associations between genetic variation in one-carbon metabolism and leukocyte DNA methylation in valproate-treated patients with epilepsy. Clin. Nutr. 2018, 37, 308–312. [Google Scholar] [CrossRef]
  33. Coppedè, F.; Grossi, E.; Lopomo, A.; Spisni, R.; Buscema, M.; Migliore, L. Application of artificial neural networks to link genetic and environmental factors to DNA methylation in colorectal cancer. Epigenomics 2015, 7, 175–186. [Google Scholar] [CrossRef] [PubMed]
  34. Ma, L.M.; Yang, H.P.; Yang, X.W.; Ruan, L.H. Methionine synthase A2756G polymorphism influences pediatric acute lymphoblastic leukemia risk: A meta-analysis. Biosci. Rep. 2019, 39, BSR20181770. [Google Scholar] [CrossRef] [PubMed]
  35. Schraw, J.M.; Yiu, T.T.; Lupo, P.J.; Tsavachidis, S.; Rau, R.; Bondy, M.L.; Rabin, K.R.; Shen, L.; Scheurer, M.E. Maternal folate genes and aberrant DNA hypermethylation in pediatric acute lymphoblastic leukemia. PLoS ONE 2018, 13, e0197408. [Google Scholar] [CrossRef]
  36. Salimi, S.; Keshavarzi, F.; Mohammadpour-Gharehbagh, A.; Moodi, M.; Mousavi, M.; Karimian, M.; Sandoughi, M. Polymorphisms of the folate metabolizing enzymes: Association with SLE susceptibility and in silico analysis. Gene 2017, 637, 161–172. [Google Scholar] [CrossRef]
  37. Shao, H.B.; Ren, K.; Gao, S.L.; Zou, J.G.; Mi, Y.Y.; Zhang, L.F.; Zuo, L.; Okada, A.; Yasui, T. Human methionine synthase A2756G polymorphism increases susceptibility to prostate cancer. Aging (Albany NY) 2018, 10, 1776–1788. [Google Scholar] [CrossRef]
  38. Jiang-Hua, Q.; De-Chuang, J.; Zhen-Duo, L.; Shu-de, C.; Zhenzhen, L. Association of methylenetetrahydrofolate reductase and methionine synthase polymorphisms with breast cancer risk and interaction with folate, vitamin B6, and vitamin B 12 intakes. Tumour Biol. 2014, 35, 11895–11901. [Google Scholar] [CrossRef]
  39. Surace, A.E.A.; Hedrich, C.M. The Role of Epigenetics in Autoimmune/Inflammatory Disease. Front. Immunol. 2019, 10, 1525. [Google Scholar] [CrossRef] [Green Version]
  40. Lightfoot, T.J.; Skibola, C.F.; Willett, E.V.; Skibola, D.R.; Allan, J.M.; Coppede, F.; Adamson, P.J.; Morgan, G.J.; Roman, E.; Smith, M.T. Risk of non-Hodgkin lymphoma associated with polymorphisms in folate-metabolizing genes. Cancer Epidemiol. Biomark. Prev. 2005, 14, 2999–3003. [Google Scholar] [CrossRef] [Green Version]
  41. Weng, Y.; Zhang, J.; Tang, X.; Xie, X.; Chen, G. Thymidylate synthase polymorphisms and hematological cancer risk: A meta-analysis. Leuk. Lymphoma 2012, 53, 1345–1351. [Google Scholar] [CrossRef]
  42. Wang, J.; Wang, B.; Bi, J.; Di, J. The association between two polymorphisms in the TYMS gene and breast cancer risk: A meta-analysis. Breast Cancer Res. Treat. 2011, 128, 203–209. [Google Scholar] [CrossRef]
  43. Lopomo, A.; Ricciardi, R.; De Rosa, A.; Guida, M.; Maestri, M.; Lucchi, M.; Melfi, F.; Mussi, A.; Migliore, L.; Coppedè, F. The thymidylate synthase enhancer region (TSER) polymorphism increases the risk of thymic lymphoid hyperplasia in patients with Myasthenia Gravis. Gene 2018, 642, 376–380. [Google Scholar] [CrossRef] [PubMed]
  44. Rupasree, Y.; Naushad, S.M.; Rajasekhar, L.; Kutala, V.K. Epigenetic modulation of RFC1, MHC2TA and HLA-DR in systemic lupus erythematosus: Association with serological markers and six functional polymorphisms of one-carbon metabolic pathway. Gene 2014, 536, 45–52. [Google Scholar] [CrossRef]
  45. Childebayeva, A.; Jones, T.R.; Goodrich, J.M.; Leon-Velarde, F.; Rivera-Chira, M.; Kiyamu, M.; Brutsaert, T.D.; Dolinoy, D.C.; Bigham, A.W. LINE-1 and EPAS1 DNA methylation associations with high-altitude exposure. Epigenetics 2019, 14, 1–15. [Google Scholar] [CrossRef] [Green Version]
  46. Karpinski, P.; Myszka, A.; Ramsey, D.; Misiak, B.; Gil, J.; Laczmanska, I.; Grzebieniak, Z.; Sebzda, T.; Smigiel, R.; Stembalska, A.; et al. Polymorphisms in methyl-group metabolism genes and risk of sporadic colorectal cancer with relation to the CpG island methylator phenotype. Cancer Epidemiol. 2010, 34, 338–344. [Google Scholar] [CrossRef] [Green Version]
  47. Song, M.A.; Brasky, T.M.; Marian, C.; Weng, D.Y.; Taslim, C.; Llanos, A.A.; Dumitrescu, R.G.; Liu, Z.; Mason, J.B.; Spear, S.L.; et al. Genetic variation in one-carbon metabolism in relation to genome-wide DNA methylation in breast tissue from heathy women. Carcinogenesis 2016, 37, bgw030. [Google Scholar] [CrossRef] [Green Version]
  48. Coppedè, F.; Tannorella, P.; Pezzini, I.; Migheli, F.; Ricci, G.; Caldarazzo lenco, E.; Piaceri, I.; Polini, A.; Nacmias, B.; Monzani, F.; et al. Folate, homocysteine, vitamin B12, and polymorphisms of genes participating in one-carbon metabolism in late-onset Alzheimer’s disease patients and healthy controls. Antioxid. Redox Signal. 2012, 17, 195–204. [Google Scholar] [CrossRef]
  49. Coppedè, F.; Grossi, E.; Buscema, M.; Migliore, L. Application of artificial neural networks to investigate one-carbon metabolism in Alzheimer’s disease and healthy matched individuals. PLoS ONE 2013, 8, e74012. [Google Scholar] [CrossRef]
  50. Tannorella, P.; Stoccoro, A.; Tognoni, G.; Bonuccelli, U.; Migliore, L.; Coppedè, F. Association study between the DNMT3A -448A > G polymorphism and risk of Alzheimer’s disease in Caucasians of Italian origin. Am. J. Neurodegener. Dis. 2016, 5, 85–93. [Google Scholar]
  51. Tannorella, P.; Stoccoro, A.; Tognoni, G.; Petrozzi, L.; Salluzzo, M.G.; Ragalmuto, A.; Siciliano, G.; Haslberger, A.; Bosco, P.; Bonuccelli, U.; et al. Methylation analysis of multiple genes in blood DNA of Alzheimer’s disease and healthy individuals. Neurosci. Lett. 2015, 600, 143–147. [Google Scholar] [CrossRef]
  52. Migheli, F.; Stoccoro, A.; Coppedè, F.; Wan Omar, W.A.; Failli, A.; Consolini, R.; Seccia, M.; Spisni, R.; Miccoli, P.; Mathers, J.C.; et al. Comparison study of MS-HRM and pyrosequencing techniques for quantification of APC and CDKN2A gene methylation. PLoS ONE 2013, 8, e52501. [Google Scholar] [CrossRef] [PubMed]
Metabolites 09 00298 g001 550
Figure 1. Simplified overview of the folate (light brown color) and methionine (heavenly color) cycles in one-carbon metabolism, adapted from Reference [4]. The diagram illustrates the enzymes (green color) whose polymorphisms were investigated in this article, and their metabolites or cofactors (those analyzed in the present study are in red). Enzymes: DNMTs, DNA methyltransferases; MTHFR, methylenetetrahydrofolate reductase; MTR, methionine synthase; MTRR, methionine synthase reductase; RFC1, reduced folate carrier 1; TYMS, thymidilate synthase. Metabolites: DHF, dihydrofolate; THF, tetrahydrofolate; dTMP, deoxythymidine monophosphate; dUMP, deoxyuridine monophosphate; SAH, S-adenosylhomocysteine; SAM, S-adenosylmethionine.
Figure 1. Simplified overview of the folate (light brown color) and methionine (heavenly color) cycles in one-carbon metabolism, adapted from Reference [4]. The diagram illustrates the enzymes (green color) whose polymorphisms were investigated in this article, and their metabolites or cofactors (those analyzed in the present study are in red). Enzymes: DNMTs, DNA methyltransferases; MTHFR, methylenetetrahydrofolate reductase; MTR, methionine synthase; MTRR, methionine synthase reductase; RFC1, reduced folate carrier 1; TYMS, thymidilate synthase. Metabolites: DHF, dihydrofolate; THF, tetrahydrofolate; dTMP, deoxythymidine monophosphate; dUMP, deoxyuridine monophosphate; SAH, S-adenosylhomocysteine; SAM, S-adenosylmethionine.
Metabolites 09 00298 g001
Metabolites 09 00298 g002 550
Figure 2. Melting curve of the DNMT1 gene promoter showing in blue the standard samples with known methylation percentages (0%, 25%, 50%, 75%, 100%) and a sample in duplicate (red curve) showing a methylation of about 6%.
Figure 2. Melting curve of the DNMT1 gene promoter showing in blue the standard samples with known methylation percentages (0%, 25%, 50%, 75%, 100%) and a sample in duplicate (red curve) showing a methylation of about 6%.
Metabolites 09 00298 g002
Metabolites 09 00298 g003 550
Figure 3. Correlation between DNMT1 promoter methylation and circulating folate (A), homocysteine (Hcy) (B), and vitamin B12 levels (C).
Figure 3. Correlation between DNMT1 promoter methylation and circulating folate (A), homocysteine (Hcy) (B), and vitamin B12 levels (C).
Metabolites 09 00298 g003
Metabolites 09 00298 g004 550
Figure 4. Analysis of variance showing gender differences in folate (A), Hcy (B), vitamin B12 (C), and DNMT1 methylation levels (D). Data are expressed as means ± standard error of the mean (SEM).
Figure 4. Analysis of variance showing gender differences in folate (A), Hcy (B), vitamin B12 (C), and DNMT1 methylation levels (D). Data are expressed as means ± standard error of the mean (SEM).
Metabolites 09 00298 g004
Metabolites 09 00298 g005 550
Figure 5. Correlation between age and circulating folate (A), Hcy (B), vitamin B12 levels (C), and DNMT1 promoter methylation levels (D).
Figure 5. Correlation between age and circulating folate (A), Hcy (B), vitamin B12 levels (C), and DNMT1 promoter methylation levels (D).
Metabolites 09 00298 g005
Metabolites 09 00298 g006 550
Figure 6. Analysis of variance (ANOVA) showing the differences in DNMT1 methylation levels among carriers of different genotypes, adjusted for age and gender (A–I). Data are expressed as means ± SEM. Only Bonferroni’s corrected p-values (< 0.05) are shown. We grouped together heterozygous (AG) and homozygous (GG) MTR carriers (D) because only three subjects in our cohort showed the mutant MTR 2756GG genotype.
Figure 6. Analysis of variance (ANOVA) showing the differences in DNMT1 methylation levels among carriers of different genotypes, adjusted for age and gender (A–I). Data are expressed as means ± SEM. Only Bonferroni’s corrected p-values (< 0.05) are shown. We grouped together heterozygous (AG) and homozygous (GG) MTR carriers (D) because only three subjects in our cohort showed the mutant MTR 2756GG genotype.
Metabolites 09 00298 g006
Table
Table 1. Study population.
Table 1. Study population.
Number of SubjectsAge (Years)
Mean ± SD		GenderFolate * (ng/mL)
Mean ± SD (SEM)		Hcy * (μmol/L)
Mean ± SD (SEM)		Vitamin B12 * (pg/mL)
Mean ± SD (SEM)		DNMT1 Methylation (%)
Mean ± SD (SEM)
Total: N = 21576.4 ± 9.6M: 85
F: 130		---2.2 ± 2.5
(SEM = 0.2)
Subgroup with biochemical data: N = 15874.9 ± 9.3M: 69
F: 89		7.16 ± 4.86
(SEM = 0.39)		14.36 ± 7.1
(SEM = 0.56)		495.6 ± 404.3
(SEM = 32.3)		2.1 ± 2.7
(SEM = 0.2)
* Data available from the subgroup of 158 individuals. M—male; F—female; SEM—standard error of the mean; Hcy—homocysteine.
Table
Table 2. Distribution of genotypes in the study population; indel—insertion/deletion.
Table 2. Distribution of genotypes in the study population; indel—insertion/deletion.
PolymorphismGenotypes: N of Subjects (%)
MTHFR 677C > TCC: 77 (35.8%), CT: 94 (43.7%), TT: 44 (20.5%)
MTHFR 1298A > CAA: 101 (47%), AC: 92 (42.8%), CC: 22 (10.2%)
MTRR 66A > GAA: 63 (29.3%), AG: 116 (54.0%), GG: 36 (16.7%)
MTR 2756A > GAA: 164 (76.3%), AG: 48 (22.3 %), GG: 3 (1.4%)
RFC-1 80G > AGG: 60 (27.9%), GA: 119 (55.3%), AA: 36 (16.8%)
TYMS 28-bp Repeats3R3R: 60 (27.9%), 3R2R: 116 (53.9%), 2R2R: 39 (18.2%)
TYMS 1494 6-bp indelin/in: 67 (31.2%), in/del: 114 (53.0%), del/del: 34 (15.8%)
DNMT3A -448A > GGG: 173 (80.4%), GA: 42 (19.6%), AA: 0 (0.0%)
DNMT3B -149C > TCC: 89 (41.4%), CT: 107 (49.7%), TT: 19 (8.9%)
Table
Table 3. Primers and annealing temperature (Ta) used during methylation-sensitive high-resolution melting (MS-HRM) analysis, as well as amplicon length, region analyzed respect to the Transcription Start Site (TSS), number of cytosine–phosphate–guanine (CpG) sites, accession number, and nucleotide position of the DNMT1 region analyzed. F—forward; R—reverse.
Table 3. Primers and annealing temperature (Ta) used during methylation-sensitive high-resolution melting (MS-HRM) analysis, as well as amplicon length, region analyzed respect to the Transcription Start Site (TSS), number of cytosine–phosphate–guanine (CpG) sites, accession number, and nucleotide position of the DNMT1 region analyzed. F—forward; R—reverse.
Primer SequencesTaAmplicon LengthRegion Respect to TSSCpG SitesAccession Number and Nucleotide Position
F: 5′–GGTATCGTGTTTATTTTTTAGTAA–3′
R: 5′–ACGAAACCAACCATACCCAA–3′		52 °C114 bpFrom −106 to +89NG_028016.3
41101–41215

Share and Cite

MDPI and ACS Style

Coppedè, F.; Stoccoro, A.; Tannorella, P.; Migliore, L. Plasma Homocysteine and Polymorphisms of Genes Involved in Folate Metabolism Correlate with DNMT1 Gene Methylation Levels. Metabolites 2019, 9, 298. https://doi.org/10.3390/metabo9120298

AMA Style

Coppedè F, Stoccoro A, Tannorella P, Migliore L. Plasma Homocysteine and Polymorphisms of Genes Involved in Folate Metabolism Correlate with DNMT1 Gene Methylation Levels. Metabolites. 2019; 9(12):298. https://doi.org/10.3390/metabo9120298

Chicago/Turabian Style

Coppedè, Fabio, Andrea Stoccoro, Pierpaola Tannorella, and Lucia Migliore. 2019. "Plasma Homocysteine and Polymorphisms of Genes Involved in Folate Metabolism Correlate with DNMT1 Gene Methylation Levels" Metabolites 9, no. 12: 298. https://doi.org/10.3390/metabo9120298

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop