Improved Antioxidative, Anti-Inflammatory, and Antimelanogenic Effects of Fermented Hydroponic Ginseng with Bacillus Strains
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Bacteria Strain and Cell Culture Conditions
2.3. Preparation of HG
2.4. Liquid-State Fermentation of HG
2.5. Total Phenolic and Total Flavonoid Contents
2.6. 2,2′-Azino-bis(3-ethylbenz-thiazoline-6-sulfonic Acid (ABTS) and Ferric Reducing Antioxidant Power (FRAP) Assay
2.7. Cell Viability of RAW 264.7 and B16F10 Cells
2.8. Cellular Nitric Oxide (NO) Production in RAW 264.7 Cells
2.9. Cellular Tyrosinase Activity and Melanin Content in B16F10 Cells
2.10. L-DOPA Staining Assay of B16F10 Cells
2.11. Relative Quantification of Gene Expression by Quantitative Real-Time PCR
2.12. Enzyme-Linked Immunosorbent Assay (ELISA)
2.13. Statistical Analysis
3. Results
3.1. Growth of Bacillus Stains during Fermentation of HG
3.2. Total Phenolic Content (TPC), Total Flavonoid Content (TFC), and Antioxidant Activities (ABTS and FRAP)
3.3. Anti-Inflammatory Effect in LPS-Induced RAW 264.7 Cells
3.3.1. Cell Viability and Cellular NO Production
3.3.2. mRNA Expressions of iNOS, COX-2, TNF-α, IL-1β, and IL-6
3.3.3. Protein Concentrations of PGE2 and Cytokines (TNF-α, IL-1β, and IL-6)
3.4. Antimelanogenic Effects in B16F10 Cells
3.4.1. Cell Viability, Cellular Melanin Content, and Cellular Tyrosinase Activity
3.4.2. L-DOPA Staining
3.4.3. Gene Expressions of MITF and Melanogenic Proteins (Tyrosinase, TRP-1, and TRP-2)
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Gillis, C.N. Panax Ginseng Pharmacology: A Nitric Oxide Link? Biochem. Pharmacol. 1997, 54, 1–8. [Google Scholar] [CrossRef]
- Song, H.-Y.; Kim, H.-M.; Kim, W.S.; Byun, E.-H.; Jang, B.-S.; Choi, D.S.; Byun, E.-B. Effect of Gamma Irradiation on the Anti-Oxidant and Anti-Melanogenic Activity of Black Ginseng Extract in B16F10 Melanoma Cells. Radiat. Phys. Chem. 2018, 149, 33–40. [Google Scholar] [CrossRef]
- Attele, A.S.; Wu, J.A.; Yuan, C.-S. Ginseng Pharmacology: Multiple Constituents and Multiple Actions. Biochem. Pharmacol. 1999, 58, 1685–1693. [Google Scholar] [CrossRef]
- Yang, S.; Li, F.; Lu, S.; Ren, L.; Bian, S.; Liu, M.; Zhao, D.; Wang, S.; Wang, J. Ginseng Root Extract Attenuates Inflammation by Inhibiting the MAPK/NF-ΚB Signaling Pathway and Activating Autophagy and P62-Nrf2-Keap1 Signaling in Vitro and in vivo. J. Ethnopharmacol. 2022, 283, 114739. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.Y.; Yang, H.; Lee, T.K.; Lee, C.H.; Seo, J.W.; Kim, J.-E.; Kim, S.Y.; Park, J.H.Y.; Lee, K.W. A Short-Term, Hydroponic-Culture of Ginseng Results in a Significant Increase in the Anti-Oxidative Activity and Bioactive Components. Food Sci. Biotechnol. 2020, 29, 1007–1012. [Google Scholar] [CrossRef]
- Choi, S.Y.; Cho, C.-W.; Lee, Y.; Kim, S.S.; Lee, S.H.; Kim, K.-T. Comparison of Ginsenoside and Phenolic Ingredient Contents in Hydroponically-Cultivated Ginseng Leaves, Fruits, and Roots. J. Ginseng Res. 2012, 36, 425. [Google Scholar] [CrossRef]
- Lee, T.K.; Lee, J.Y.; Cho, Y.-J.; Kim, J.-E.; Kim, S.Y.; Park, J.H.Y.; Yang, H.; Lee, K.W. Optimization of the Extraction Process of High Levels of Chlorogenic Acid and Ginsenosides from Short-Term Hydroponic-Cultured Ginseng and Evaluation of the Extract for the Prevention of Atopic Dermatitis. J. Ginseng Res. 2022, 46, 367–375. [Google Scholar] [CrossRef]
- Hwang, J.E.; Suh, D.H.; Kim, K.-T.; Paik, H.-D. Comparative Study on Anti-Oxidative and Anti-Inflammatory Properties of Hydroponic Ginseng and Soil-Cultured Ginseng. Food Sci. Biotechnol. 2019, 28, 215–224. [Google Scholar] [CrossRef]
- Chou, S.-T.; Lai, C.-C.; Lai, C.-P.; Chao, W.-W. Chemical Composition, Antioxidant, Anti-Melanogenic and Anti-Inflammatory Activities of Glechoma Hederacea (Lamiaceae) Essential Oil. Ind. Crops Prod. 2018, 122, 675–685. [Google Scholar] [CrossRef]
- Hsu, B.Y.; Lu, T.J.; Chen, C.H.; Wang, S.J.; Hwang, L.S. Biotransformation of Ginsenoside Rd in the Ginseng Extraction Residue by Fermentation with Lingzhi (Ganoderma Lucidum). Food Chem. 2013, 141, 4186–4193. [Google Scholar] [CrossRef]
- Cho, K.M.; Lee, H.Y.; Lee, Y.M.; Seo, E.Y.; Son, K.-H.; Lee, J.; Cho, D.Y.; Lee, J.H. Comparative Assessment of Compositional Constituents and Antioxidant Effects in Ginseng Sprouts (Panax Ginseng) through Aging and Fermentation Processes. LWT 2022, 164, 113644. [Google Scholar] [CrossRef]
- Park, B.-G.; Jung, H.-J.; Cho, Y.-W.; Lim, H.-W.; Lim, C.-J. Potentiation of Antioxidative and Anti-Inflammatory Properties of Cultured Wild Ginseng Root Extract through Probiotic Fermentation. J. Pharm. Pharmacol. 2013, 65, 457–464. [Google Scholar] [CrossRef] [PubMed]
- Fan, J.; Liu, S.; Ai, Z.; Chen, Y.; Wang, Y.; Li, Y.; Li, X.; Xiao, S.; Wang, Y. Fermented Ginseng Attenuates Lipopolysaccharide-Induced Inflammatory Responses by Activating the TLR4/MAPK Signaling Pathway and Remediating Gut Barrier. Food Funct. 2021, 12, 852–861. [Google Scholar] [CrossRef]
- Lee, H.-S.; Kim, M.-R.; Park, Y.; Park, H.J.; Chang, U.J.; Kim, S.Y.; Suh, H.J. Fermenting Red Ginseng Enhances Its Safety and Efficacy as a Novel Skin Care Anti-Aging Ingredient: In Vitro and Animal Study. J. Med. Food 2012, 15, 1015–1023. [Google Scholar] [CrossRef]
- Hwang, J.E.; Kim, K.-T.; Paik, H.-D. Improved Antioxidant, Anti-Inflammatory, and Anti-Adipogenic Properties of Hydroponic Ginseng Fermented by Leuconostoc Mesenteroides KCCM 12010P. Molecules 2019, 24, 3359. [Google Scholar] [CrossRef]
- Song, M.-W.; Park, J.-Y.; Lee, H.-S.; Kim, K.-T.; Paik, H.-D. Co-Fermentation by Lactobacillus Brevis B7 Improves the Antioxidant and Immunomodulatory Activities of Hydroponic Ginseng-Fortified Yogurt. Antioxidants 2021, 10, 1447. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.-H.; Lee, Y.-C.; Kim, S.-S.; Hong, H.-D.; Kim, K.-T. Quality and Antioxidant Activity of Ginseng Seed Processed by Fermentation Strains. J. Ginseng Res. 2015, 39, 178–182. [Google Scholar] [CrossRef]
- Kim, H.-Y.; Bae, W.-Y.; Yu, H.-S.; Chang, K.-H.; Hong, Y.-H.; Lee, N.-K.; Paik, H.-D. Inula Britannica Fermented with Probiotic Weissella Cibaria D30 Exhibited Anti-Inflammatory Effect and Increased Viability in RAW 264.7 Cells. Food Sci. Biotechnol. 2020, 29, 569–578. [Google Scholar] [CrossRef]
- Yu, H.-S.; Lee, N.-K.; Choi, A.-J.; Choe, J.-S.; Bae, C.H.; Paik, H.-D. Anti-Inflammatory Potential of Probiotic Strain Weissella Cibaria JW15 Isolated from Kimchi through Regulation of NF-ΚB and MAPKs Pathways in LPS-Induced RAW 264.7 Cells. J. Microbiol. Biotechnol. 2019, 29, 1022–1032. [Google Scholar] [CrossRef]
- Wang, H.M.; Qu, L.Q.; Ng, J.P.L.; Zeng, W.; Yu, L.; Song, L.L.; Wong, V.K.W.; Xia, C.L.; Law, B.Y.K. Natural Citrus Flavanone 5-Demethylnobiletin Stimulates Melanogenesis through the Activation of CAMP/CREB Pathway in B16F10 Cells. Phytomedicine 2022, 98, 153941. [Google Scholar] [CrossRef]
- Park, E.; Bae, W.; Kim, J.; Kim, K.; Paik, H. Antimelanogenic Effects of Inula Britannica Flower Petal Extract Fermented by Lactobacillus Plantarum KCCM 11613P. J. Zhejiang Univ. Sci. B 2017, 18, 816–824. [Google Scholar] [CrossRef]
- Oh, T.-I.; Yun, J.-M.; Park, E.-J.; Kim, Y.-S.; Lee, Y.-M.; Lim, J.-H. Plumbagin Suppresses α-MSH-Induced Melanogenesis in B16F10 Mouse Melanoma Cells by Inhibiting Tyrosinase Activity. Int. J. Mol. Sci. 2017, 18, 320. [Google Scholar] [CrossRef] [PubMed]
- Chatatikun, M.; Yamauchi, T.; Yamasaki, K.; Aiba, S.; Chiabchalard, A. Anti Melanogenic Effect of Croton Roxburghii and Croton Sublyratus Leaves in α-MSH Stimulated B16F10 Cells. J. Tradit. Complement Med. 2019, 9, 66–72. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.S.; Yu, H.-S.; Lee, J.H.; Lee, G.W.; Choi, S.J.; Chang, P.-S.; Paik, H.-D. Application of Stabilizer Improves Stability of Nanosuspended Branched-Chain Amino Acids and Anti-Inflammatory Effect in LPS-Induced RAW 264.7 Cells. Food Sci. Biotechnol. 2018, 27, 451–459. [Google Scholar] [CrossRef] [PubMed]
- Ramesh, T.; Kim, S.-W.; Sung, J.-H.; Hwang, S.-Y.; Sohn, S.-H.; Yoo, S.-K.; Kim, S.-K. Effect of Fermented Panax Ginseng Extract (GINST) on Oxidative Stress and Antioxidant Activities in Major Organs of Aged Rats. Exp. Gerontol. 2012, 47, 77–84. [Google Scholar] [CrossRef]
- Baek, K.-S.; Yi, Y.-S.; Son, Y.-J.; Yoo, S.; Sung, N.Y.; Kim, Y.; Hong, S.; Aravinthan, A.; Kim, J.-H.; Cho, J.Y. In Vitro and in Vivo Anti-Inflammatory Activities of Korean Red Ginseng-Derived Components. J. Ginseng Res. 2016, 40, 437–444. [Google Scholar] [CrossRef]
- Jung, H.-J.; Choi, H.; Lim, H.-W.; Shin, D.; Kim, H.; Kwon, B.; Lee, J.E.; Park, E.-H.; Lim, C.-J. Enhancement of Anti-Inflammatory and Antinociceptive Actions of Red Ginseng Extract by Fermentation. J. Pharm. Pharm. 2012, 64, 756–762. [Google Scholar] [CrossRef]
- Im, D.-S. Pro-Resolving Effect of Ginsenosides as an Anti-Inflammatory Mechanism of Panax Ginseng. Biomolecules 2020, 10, 444. [Google Scholar] [CrossRef]
- Ai, Z.; You, Y.; Li, W.; Fan, J.; Wang, Y.; Huang, J.; Wang, Y.; Wang, Y.; Liu, J. Enhanced Uronic Acid Content, Antioxidant, and Anti-inflammatory Activities of Polysaccharides from Ginseng Fermented by Saccharomyces Cerevisiae GIW-1. J. Food Process. Preserv. 2020, 44, e14885. [Google Scholar] [CrossRef]
- Akaberi, M.; Emami, S.A.; Vatani, M.; Tayarani-Najaran, Z. Evaluation of Antioxidant and Anti-Melanogenic Activity of Different Extracts of Aerial Parts of N. Sintenisii in Murine Melanoma B16F10 Cells. Iran. J. Pharm. Res. 2018, 17, 225. [Google Scholar]
- Lee, H.-R.; Jung, J.M.; Seo, J.-Y.; Chang, S.E.; Song, Y. Anti-Melanogenic Property of Ginsenoside Rf from Panax Ginseng via Inhibition of CREB/MITF Pathway in Melanocytes and Ex Vivo Human Skin. J. Ginseng Res. 2021, 45, 555–564. [Google Scholar] [CrossRef]
- Hearing, V.J. Biochemical Control of Melanogenesis and Melanosomal Organization. J. Investig. Dermatol. Symp. Proc. 1999, 4, 24–28. [Google Scholar] [CrossRef] [PubMed]
- Hwang, E.-Y.; Choi, S.-Y. Quantitative Analysis of Phenolic Compounds in Different Parts of Panax Ginseng CA Meyer and Its Inhibitory Effect on Melanin Biosynthesis. Korean J. Med. Crop Sci. 2006, 14, 148–152. [Google Scholar]
- Jiang, R.; Xu, X.-H.; Wang, K.; Yang, X.-Z.; Bi, Y.-F.; Yan, Y.; Liu, J.-Z.; Chen, X.-N.; Wang, Z.-Z.; Guo, X.-L. Ethyl Acetate Extract from Panax Ginseng CA Meyer and Its Main Constituents Inhibit α-Melanocyte-Stimulating Hormone-Induced Melanogenesis by Suppressing Oxidative Stress in B16 Mouse Melanoma Cells. J. Ethnopharmacol. 2017, 208, 149–156. [Google Scholar] [CrossRef] [PubMed]
Gene 1 | Forward | Reverse | Accession Number |
---|---|---|---|
RAW 264.7 cells | |||
iNOS | CCCTTCCGAAGTTTCTGGCAGCAGC | GGCTGTCAGAGCCTCG-TGGCTTTGG | NM_010927 |
COX-2 | CACTACATCCTGACCCACTT | ATGCTCCTGCTTGAGTATGT | NM_011198 |
TNF-α | TTGACCTCAGCGCTGAGTTG | CCTGTAGCCCACGTCGTAGC | NM_013693 |
IL-1β | CAGGATGAGGACATGAGCACC | CTCTGCAGACTCAAACTCCAC | NM_008361 |
IL-6 | GTACTCCAGAAGACCAGAGG | TGCTGGTGACAACCACGGCC | NM_031168 |
β-Actin | GTGGGCCGCCCTAGGCACCAG | GGAGGAAGAGGATGCGGCAGT | NM_007393 |
B16F10 cells | |||
MITF | TTACCAACAACCTCGGCACCAT | CTCCTGGCGACACTGATGACA | NM_001113198 |
Tyrosinase | CCTCCTGGCAGATCATTTGT | GGTTTTGGCTTTGTCATGGT | NM_011661 |
TRP-1 | TTGCTGTAGTGGCTGCGTTGTT | AGGAGAGGCTGGTTGGCTTCAT | NM_031202 |
TRP-2 | GCAAGAGATACACGGAGGAAG | CTAAGGCATCATCATCATCACTAC | NM_010024 |
β-Actin | AGCCATGTACGTAGCCATCC | CTCTCAGCTGTGGTGGTGAA | NM_007393 |
Samples | Nonfermented HG | Fermented HG | |||
---|---|---|---|---|---|
NF | B. subtilis KU43 | B. subtilis KU201 | B. polyfermeticus SCD | B. polyfermeticus KU3 | |
TPC (mg GAE/g) | 51.62 ± 1.50 e | 66.34 ± 2.47 d | 90.22 ± 1.50 a | 76.48 ± 0.57 b | 71.57 ± 0.57 c |
TFC (mg QE/g) | 24.33 ± 0.71 c | 36.27 ± 1.75 b | 43.27 ± 4.99 a | 42.04 ± 2.85 a | 26.39 ± 2.14 c |
ABTS 1 (%) | 25.30 ± 0.01 e | 34.00 ± 0.01 d | 51.34 ± 0.01 a | 36.88 ± 0.01 c | 40.62 ± 0.01 b |
FRAP 1 (μM) | 132.10 ± 2.19 d | 176.30 ± 0.00 c | 236.27 ± 11.42 a | 207.86 ± 9.34 b | 199.66 ± 1.09 b |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, J.-Y.; Song, M.W.; Kim, K.-T.; Paik, H.-D. Improved Antioxidative, Anti-Inflammatory, and Antimelanogenic Effects of Fermented Hydroponic Ginseng with Bacillus Strains. Antioxidants 2022, 11, 1848. https://doi.org/10.3390/antiox11101848
Park J-Y, Song MW, Kim K-T, Paik H-D. Improved Antioxidative, Anti-Inflammatory, and Antimelanogenic Effects of Fermented Hydroponic Ginseng with Bacillus Strains. Antioxidants. 2022; 11(10):1848. https://doi.org/10.3390/antiox11101848
Chicago/Turabian StylePark, Ji-Young, Myung Wook Song, Kee-Tae Kim, and Hyun-Dong Paik. 2022. "Improved Antioxidative, Anti-Inflammatory, and Antimelanogenic Effects of Fermented Hydroponic Ginseng with Bacillus Strains" Antioxidants 11, no. 10: 1848. https://doi.org/10.3390/antiox11101848