Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Article
  • Published:

Condensates in RNA repeat sequences are heterogeneously organized and exhibit reptation dynamics

Nature Chemistry volume 14, pages 775–785 (2022)Cite this article

Subjects

Abstract

Although it is known that RNA undergoes liquid–liquid phase separation, the interplay between the molecular driving forces and the emergent features of the condensates, such as their morphologies and dynamic properties, is not well understood. We introduce a coarse-grained model to simulate phase separation of trinucleotide repeat RNAs, which are implicated in neurological disorders. After establishing that the simulations reproduce key experimental findings, we show that once recruited inside the liquid droplets, the monomers transition from hairpin-like structures to extended states. Interactions between the monomers in the condensates result in the formation of an intricate and dense intermolecular network, which severely restrains the fluctuations and mobilities of the RNAs inside large droplets. In the largest densely packed high-viscosity droplets, the mobility of RNA chains is best characterized by reptation, reminiscent of the dynamics in polymer melts. Our work provides a microscopic framework for understanding liquid–liquid phase separation in RNA, which is not easily discernible in current experiments.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Fig. 1: Liquid–liquid phase separation of CAG repeat RNAs.
Fig. 2: Comparison of the structures of (CAG)47 inside the condensates and in isolation.
Fig. 3: Intermolecular hydrogen bonding drives LLPS in RNA.
Fig. 4: Structural heterogeneity of the RNA chains in large and dense (CAG)47 droplets.
Fig. 5: Condensate dynamics.
Fig. 6: Visualization of the dynamics of monomer recruited into a droplet for (CAG)47.
Fig. 7: Dynamics of RNA chains in (CAG)47 condensates is heterogeneous.

Similar content being viewed by others

Data availability

All data are included in the paper and the Supplementary Information. The raw data are available on Zenodo at https://zenodo.org/record/5794441.90

Code availability

The codes to perform simulations and analyses are available at GitHub (https://github.com/tienhungf91/RNA_llps).

References

  1. Brangwynne, C. P. et al. Germline P granules are liquid droplets that localize by controlled dissolution/condensation. Science 324, 1729–1732 (2009).

    Article  CAS  PubMed  Google Scholar 

  2. Hyman, A. A., Weber, C. A. & Julicher, F. Liquid–liquid phase separation in biology. Annu. Rev. Cell Dev. Biol. 30, 39–58 (2014).

    Article  CAS  PubMed  Google Scholar 

  3. Brangwynne, C. P., Tompa, P. & Pappu, R. V. Polymer physics of intracellular phase transitions. Nat. Phys. 11, 899–904 (2015).

    Article  CAS  Google Scholar 

  4. Shin, Y. & Brangwynne, C. P. Liquid phase condensation in cell physiology and disease. Science 357, eaaf4382 (2017).

    Article  PubMed  CAS  Google Scholar 

  5. Banani, S. F., Lee, H. O., Hyman, A. A. & Rosen, M. K. Biomolecular condensates: organizers of cellular biochemistry. Nat. Rev. Mol. Cell Biol. 18, 285–298 (2017).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Langdon, E. M. & Gladfelter, A. S. A new lens for RNA localization: liquid–liquid phase separation. Annu. Rev. Microbiology 72, 255–271 (2018).

    Article  CAS  Google Scholar 

  7. Berry, J., Brangwynne, C. P. & Haataja, M. Physical principles of intracellular organization via active and passive phase transitions. Rep. Prog. Phys. 81, 046601 (2018).

    Article  PubMed  CAS  Google Scholar 

  8. Boeynaems, S. et al. Protein phase separation: a new phase in cell biology. Trends Cell Biol. 28, 420–435 (2018).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Alberti, S., Gladfelter, A. & Mittag, T. Considerations and challenges in studying liquid–liquid phase separation and biomolecular condensates. Cell 176, 419–434 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Choi, J.-M., Holehouse, A. S. & Pappu, R. V. Physical principles underlying the complex biology of intracellular phase transitions. Annu. Rev. Biophys. 49, 107–133 (2020).

    Article  CAS  PubMed  Google Scholar 

  11. Dignon, G. L., Best, R. B. & Mittal, J. Biomolecular phase separation: from molecular driving forces to macroscopic properties. Annu. Rev. Phys. Chem. 71, 53–75 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Rhine, K., Vidaurre, V. & Myong, S. RNA droplets. Annu. Rev. Biophys. 49, 247–265 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Roden, C. & Gladfelter, A. S. RNA contributions to the form and function of biomolecular condensates. Nat. Rev. Mol. Cell Biol. 22, 183–195 (2021).

    Article  CAS  PubMed  Google Scholar 

  14. Sabari, B. R., Dall’Agnese, A. & Young, R. A. Biomolecular condensates in the nucleus. Trends Biochem. Sci. 45, 961–977 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Stockmayer, W. H. Theory of molecular size distribution and gel formation in branched-chain polymers. J. Chem. Phys. 11, 45–55 (1943).

    Article  CAS  Google Scholar 

  16. Flory, P. J. Statistical Mechanics of Chain Molecules (Interscience, 1969).

    Book  Google Scholar 

  17. Semenov, A. N. & Rubinstein, M. Thermoreversible gelation in solutions of associative polymers. 1. Statics. Macromolecules 31, 1373–1385 (1998).

    Article  CAS  Google Scholar 

  18. Li, P. et al. Phase transitions in the assembly of multivalent signalling proteins. Nature 483, 336–340 (2012).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Han, T. W. et al. Cell-free formation of RNA granules: bound RNAs identify features and components of cellular assemblies. Cell 149, 768–779 (2012).

    Article  CAS  PubMed  Google Scholar 

  20. Patel, A. et al. A liquid-to-solid phase transition of the ALS protein FUS accelerated by disease mutation. Cell 162, 1066–1077 (2015).

    Article  CAS  PubMed  Google Scholar 

  21. Maharana, S. et al. RNA buffers the phase separation behavior of prion-like RNA binding proteins. Science 360, 918–921 (2018).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Schwartz, J. C., Wang, X., Podell, E. R. & Cech, T. R. RNA seeds higher-order assembly of FUS protein. Cell Rep. 5, 918–925 (2013).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Banerjee, P. R., Milin, A. N., Moosa, M. M., Onuchic, P. L. & Deniz, A. A. Reentrant phase transition drives dynamic substructure formation in ribonucleoprotein droplets. Angew. Chem. Int Ed. 129, 11512–11517 (2017).

    Article  Google Scholar 

  24. van Treeck, B. et al. RNA self-assembly contributes to stress granule formation and defining the stress granule transcriptome. Proc. Natl Acad. Sci. USA 115, 2734–2739 (2018).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. van Treeck, B. & Parker, R. Emerging roles for intermolecular RNA–RNA interactions in RNP assemblies. Cell 174, 791–802 (2018).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Langdon, E. M. et al. mRNA structure determines specificity of a polyQ-driven phase separation. Science 360, 922–927 (2018).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Boeynaems, S. et al. Spontaneous driving forces give rise to protein–RNA condensates with coexisting phases and complex material properties. Proc. Natl Acad. Sci. USA 116, 7889–7898 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Tauber, D., Tauber, G. & Parker, R. Mechanisms and regulation of RNA condensation in RNP granule formation. Trends Biochem. Sci. 45, 764–778 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Guillén-Boixet, J. et al. RNA-induced conformational switching and clustering of G3BP drive stress granule assembly by condensation. Cell 181, 346–361.e17 (2020).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  30. Sanders, D. W. et al. Competing protein–RNA interaction networks control multiphase intracellular organization. Cell 181, 306–324.e28 (2020).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  31. Kaur, T. et al. Sequence-encoded and composition-dependent protein–RNA interactions control multiphasic condensate morphologies. Nat. Commun. 12, 872 (2021).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Aumiller, W. M., Pir Cakmak, F., Davis, B. W. & Keating, C. D. RNA-based coacervates as a model for membraneless organelles: formation, properties, and interfacial liposome assembly. Langmuir 32, 10042–10053 (2016).

    Article  CAS  PubMed  Google Scholar 

  33. Jain, A. & Vale, R. D. RNA phase transitions in repeat expansion disorders. Nature 546, 243–247 (2017).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Aumiller, W. M. & Keating, C. D. Phosphorylation-mediated RNA/peptide complex coacervation as a model for intracellular liquid organelles. Nat. Chem. 8, 129–137 (2016).

    Article  CAS  PubMed  Google Scholar 

  35. Trcek, T. et al. Drosophila germ granules are structured and contain homotypic mRNA clusters. Nat. Comm. 6, 7962 (2015).

    Article  CAS  Google Scholar 

  36. Trcek, T. et al. Sequence-independent self-assembly of germ granule mRNAs into homotypic clusters. Mol. Cell 78, 941–950.e12 (2020).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  37. Gatchel, J. R. & Zoghbi, H. Y. Diseases of unstable repeat expansion: mechanisms and common principles. Nat. Rev. Genet. 6, 743–755 (2005).

    Article  CAS  PubMed  Google Scholar 

  38. La Spada, A. R. & Taylor, J. P. Repeat expansion disease: progress and puzzles in disease pathogenesis. Nat. Rev. Genet. 11, 247–258 (2010).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  39. McMurray, C. T. Mechanisms of trinucleotide repeat instability during human development. Nat. Rev. Genet. 11, 786–799 (2010).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Krzyzosiak, W. J. et al. Triplet repeat RNA structure and its role as pathogenic agent and therapeutic target. Nucl. Acids Res. 40, 11–26 (2012).

    Article  CAS  PubMed  Google Scholar 

  41. Lee, D.-Y. & McMurray, C. T. Trinucleotide expansion in disease: why is there a length threshold? Curr. Opin. Genet. Dev. 26, 131–140 (2014).

    Article  CAS  PubMed  Google Scholar 

  42. Kiliszek, A., Kierzek, R., Krzyzosiak, W. J. & Rypniewski, W. Atomic resolution structure of CAG RNA repeats: structural insights and implications for the trinucleotide repeat expansion diseases. Nucl. Acids Res. 38, 8370–8376 (2010).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. de Gennes, P. G. Reptation of a polymer chain in the presence of fixed obstacles. J. Chem. Phys. 55, 572–579 (1971).

    Article  Google Scholar 

  44. de Mezer, M., Wojciechowska, M., Napierala, M., Sobczak, K. & Krzyzosiak, W. J. Mutant CAG repeats of Huntingtin transcript fold into hairpins, form nuclear foci and are targets for RNA interference. Nucl. Acids Res. 39, 3852–3863 (2011).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  45. Ciesiolka, A., Jazurek, M., Drazkowska, K. & Krzyzosiak, W. J. Structural characteristics of simple RNA repeats associated with disease and their deleterious protein interactions. Front. Cell. Neurosci. 11, 97 (2017).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  46. Jawerth, L. et al. Protein condensates as aging Maxwell fluids. Science 370, 1317–1323 (2020).

    Article  CAS  PubMed  Google Scholar 

  47. Kato, M. et al. Cell-free formation of RNA granules: low complexity sequence domains form dynamic fibers within hydrogels. Cell 149, 753–767 (2012).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  48. Molliex, A. et al. Phase separation by low complexity domains promotes stress granule assembly and drives pathological fibrillization. Cell 163, 123–133 (2015).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  49. Lin, Y., Protter, D. S. W., Rosen, M. K. & Parker, R. Formation and maturation of phase-separated liquid droplets by RNA-binding proteins. Mol. Cell 60, 208–219 (2015).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  50. Murray, D. T. et al. Structure of FUS protein fibrils and its relevance to self-assembly and phase separation of low-complexity domains. Cell 171, 615–627.e16 (2017).

    Article  PubMed  CAS  Google Scholar 

  51. Wang, J. et al. A molecular grammar governing the driving forces for phase separation of prion-like RNA binding proteins. Cell 174, 688–699.e16 (2018).

    PubMed  PubMed Central  Google Scholar 

  52. Franzmann, T. M. et al. Phase separation of a yeast prion protein promotes cellular fitness. Science 359, eaao5654 (2018).

    Article  PubMed  CAS  Google Scholar 

  53. Wegmann, S. et al. Tau protein liquid-liquid phase separation can initiate tau aggregation. EMBO J. 37, e98049 (2018).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  54. Ray, S. et al. α-Synuclein aggregation nucleates through liquid–liquid phase separation. Nat. Chem. 12, 705–716 (2020).

    Article  CAS  PubMed  Google Scholar 

  55. Pytowski, L., Lee, C. F., Foley, A. C., Vaux, D. J. & Jean, L. Liquid–liquid phase separation of type II diabetes-associated IAPP initiates hydrogelation and aggregation. Proc. Natl Acad. Sci. USA 117, 12050–12061 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  56. Kremer, K. & Grest, G. S. Dynamics of entangled linear polymer melts: a molecular-dynamics simulation. J. Chem. Phys. 92, 5057–5086 (1990).

    Article  CAS  Google Scholar 

  57. Hsu, H.-P. & Kremer, K. Static and dynamic properties of large polymer melts in equilibrium. J. Chem. Phys. 144, 154907 (2016).

    Article  PubMed  CAS  Google Scholar 

  58. Ma, W., Zheng, G., Xie, W. & Mayr, C. In vivo reconstitution finds multivalent RNA–RNA interactions as drivers of mesh-like condensates. eLife 10, e64252 (2021).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  59. Marquis Gacy, A., Goellner, G., Juranić, N., Macura, S. & McMurray, C. T. Trinucleotide repeats that expand in human disease form hairpin structures in vitro. Cell 81, 533–540 (1995).

    Article  Google Scholar 

  60. Lai, W.-J. C. et al. mRNAs and lncRNAs intrinsically form secondary structures with short end-to-end distances. Nat. Commun. 9, 4328 (2018).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  61. Nguyen, P. H., Li, M. S., Stock, G., Straub, J. E. & Thirumalai, D. Monomer adds to preformed structured oligomers of Aβ-peptides by a two-stage dock–lock mechanism. Proc. Natl Acad. Sci. USA 104, 111–116 (2007).

    Article  CAS  PubMed  Google Scholar 

  62. Elbaum-Garfinkle, S. et al. The disordered P granule protein LAF-1 drives phase separation into droplets with tunable viscosity and dynamics. Proc. Natl Acad. Sci. USA 112, 7189–7194 (2015).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  63. Moon, S. L. et al. Multicolour single-molecule tracking of mRNA interactions with RNP granules. Nat. Cell Biol. 21, 162–168 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  64. Rouskin, S., Zubradt, M., Washietl, S., Kellis, M. & Weissman, J. S. Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo. Nature 505, 701–705 (2014).

    Article  CAS  PubMed  Google Scholar 

  65. Mortimer, S. A., Kidwell, M. A. & Doudna, J. A. Insights into RNA structure and function from genome-wide studies. Nat. Rev. Genet. 15, 469–479 (2014).

    Article  CAS  PubMed  Google Scholar 

  66. Guo, J. U. & Bartel, D. P. RNA G-quadruplexes are globally unfolded in eukaryotic cells and depleted in bacteria. Science 353, aaf5371 (2016).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  67. Tauber, D. et al. Modulation of RNA condensation by the DEAD-Box protein eIF4A. Cell 180, 411–426.e16 (2020).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  68. Onuchic, P. L., Milin, A. N., Alshareedah, I., Deniz, A. A. & Banerjee, P. R. Divalent cations can control a switch-like behavior in heterotypic and homotypic RNA coacervates. Sci. Rep. 9, 12161 (2019).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  69. Manning, G. S. The molecular theory of polyelectrolyte solutions with applications to the electrostatic properties of polynucleotides. Quart. Rev. Biophys. 11, 179–246 (1978).

    Article  CAS  Google Scholar 

  70. Bloomfield, V. A. DNA condensation by multivalent cations. Biopolymers 44, 269–282 (1997).

    Article  CAS  PubMed  Google Scholar 

  71. Bai, Y. et al. Quantitative and comprehensive decomposition of the ion atmosphere around nucleic acids. J. Am. Chem. Soc. 129, 14981–14988 (2007).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  72. Nguyen, H. T., Hori, N. & Thirumalai, D. Theory and simulations for RNA folding in mixtures of monovalent and divalent cations. Proc. Natl Acad. Sci. USA 116, 21022–21030 (2019).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  73. Lemieux, S. & Major, F. RNA canonical and non-canonical base pairing types: a recognition method and complete repertoire. Nucl. Acid Res. 30, 4250–4263 (2002).

    Article  CAS  Google Scholar 

  74. Yang, H. et al. Tools for the automatic identification and classification of RNA base pairs. Nucl. Acid Res. 31, 3450–3460 (2003).

    Article  CAS  Google Scholar 

  75. Denesyuk, N. A. & Thirumalai, D. Coarse-grained model for predicting RNA folding thermodynamics. J. Phys. Chem. B 117, 4901–4911 (2013).

    Article  CAS  PubMed  Google Scholar 

  76. Denesyuk, N. A. & Thirumalai, D. How do metal ions direct ribozyme folding? Nat. Chem. 7, 793–801 (2015).

    Article  CAS  PubMed  Google Scholar 

  77. Best, R. B., Hummer, G. & Eaton, W. A. Native contacts determine protein folding mechanisms in atomistic simulations. Proc. Natl Acad. Sci. USA 110, 17874–17879 (2013).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  78. Chen, H. et al. Ionic strength-dependent persistence lengths of single-stranded RNA and DNA. Proc. Natl Acad. Sci. USA 109, 799–804 (2012).

    Article  CAS  PubMed  Google Scholar 

  79. Kerpedjiev, P., Hammer, S. & Hofacker, I. L. Forna (force-directed RNA): simple and effective online RNA secondary structure diagrams. Bioinformatics 31, 3377–3379 (2015).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  80. Hyeon, C. & Thirumalai, D. Mechanical unfolding of RNA: from hairpins to structures with internal multiloops. Biophys. J. 92, 731–743 (2007).

    Article  CAS  PubMed  Google Scholar 

  81. Lin, J.-C. & Thirumalai, D. Relative stability of helices determines the folding landscape of adenine riboswitch aptamers. J. Am. Chem. Soc. 130, 14080–14081 (2008).

    Article  CAS  PubMed  Google Scholar 

  82. Weeks, J. D., Chandler, D. & Andersen, H. C. Role of repulsive forces in determining the equilibrium structure of simple liquids. J. Chem. Phys. 54, 5237–5247 (1971).

    Article  CAS  Google Scholar 

  83. Eastman, P. et al. OpenMM 7: rapid development of high performance algorithms for molecular dynamics. PLOS Comput. Biol. 13, e1005659 (2017).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  84. Honeycutt, J. D. & Thirumalai, D. The nature of folded states of globular proteins. Biopolymers 32, 695–709 (1992).

    Article  CAS  PubMed  Google Scholar 

  85. de Gennes, P. G. Statistics of branching and hairpin helices for the dAT copolymer. Biopolymers 6, 715–729 (1968).

    Article  PubMed  Google Scholar 

  86. Yoffe, A. M., Prinsen, P., Gelbart, W. M. & Ben-Shaul, A. The ends of a large RNA molecule are necessarily close. Nucl. Acids Res. 39, 292–299 (2011).

    Article  CAS  PubMed  Google Scholar 

  87. Clote, P., Ponty, Y. & Steyaert, J.-M. Expected distance between terminal nucleotides of RNA secondary structures. J. Math. Biol. 65, 581–599 (2012).

    Article  PubMed  Google Scholar 

  88. Leontis, N. B. & Westhof, E. Geometric nomenclature and classification of RNA base pairs. RNA 7, 499–512 (2001).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  89. Hori, N., Denesyuk, N. A. & Thirumalai, D. Shape changes and cooperativity in the folding of the central domain of the 16S ribosomal RNA. Proc. Natl Acad. Sci. USA 118, e2020837118 (2021).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  90. Nguyen, H., Hori, N. & Thirumalai, D. Raw data for ‘Condensates in RNA repeat sequences are heterogeneously organized and exhibit reptation dynamics’ (2021); https://doi.org/10.5281/zenodo.5794441

Download references

Acknowledgements

We are indebted to A. D. Bowen at the Visualization Laboratory (Vislab), Texas Advanced Computing Center, for generating the videos. We are grateful to H. Maity, S. Myong, M. Mugnai, S. Sinha and R. Takaki for stimulating discussions and critical reading of the manuscript. This work was supported by National Science Foundation Grant (CHE 19-00093) and the Welch Foundation Grant (F-0019) through the Collie–Welch chair. We thank the Texas Advanced Computing Center for providing computational resources.

Author information

Authors and Affiliations

  1. Department of Chemistry, The University of Texas at Austin, Austin, TX, USA

    Hung T. Nguyen & D. Thirumalai

  2. School of Pharmacy, University of Nottingham, Nottingham, UK

    Naoto Hori

Authors
  1. Hung T. Nguyen
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Naoto Hori
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. D. Thirumalai
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

H.T.N. and D.T. conceived and designed research, H.T.N. conducted research, H.T.N., N.H. and D.T. analysed the results and wrote the manuscript.

Corresponding author

Correspondence to D. Thirumalai.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Chemistry thanks the anonymous reviewers for their contribution to the peer review of this work.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data

Extended Data Fig. 1 Determination of the concentrations of the two coexisting phases.

Results are shown for (CAG)47. Time dependent changes in the concentrations in the aqueous phase is on the left and for the droplet is on the right. The plateau values near the end are used to calculate the concentrations at which the two phases coexist.

Extended Data Fig. 2 Structures of isolated (CAG)n monomers.

a, Distribution of the end-to-end distance Ree and b, radius of gyration Rg of (CAG)n with n=47, 31 and 20. The vertical dash lines in a indicate mean values for self-avoiding random walk chains with the same n. Snapshots are for (CAG)47. Cytosine is in cyan, adenine is in red and guanine is in black. c, Bond–bond orientational correlation function cos θ (s) as a function of the sequence distance s. The periodicity, as indicated by the vertical lines, is unmistakable. The inset shows average inter-nucleotide distances R(s) vs. s. The dashed line shows R(s) for a self-avoiding polymer (R(s) ∝ s0.588). At large s, there is an abrupt drop in R(s) because the two ends strongly interact with each other, thus bringing them to proximity. d, Contact map for (CAG)47 shows that the majority of interactions occur along the anti-diagonal, indicating the formation of hairpin structures.

Extended Data Fig. 3 Sequence of events in early droplet formation extracted from the simulation of (CAG)47.

Eleven RNA chains were chosen and coloured to see how individual chains form oligomers and grow to a single droplet. All other chains are in grey for clarity. Each panel has a label indicating the simulation time. (a) At the earliest times, all the eleven chains are monomers with no interactions between them. (b) Two chains merge to form a dimer. (c) The dimer captures another chain and becomes a trimer. There is another dimer that is formed around the same time. (d) The two oligomers further grow to a tetramer and trimer, respectively, by interacting with another chain. (e) The tetramer and trimer coalesce into a heptamer. There are still four other chains in the monomer form. (f) One of the remaining monomers joins the oligomer making it an octamer. (g) Two of the remaining monomers form a dimer. (h) It takes some time to the next event (~ 4 × 106τ from (g) to (h)). (i) The octamer eventually captures the last monomer and becomes a nonamer. (j) The nonamer and the dimer finally coalesce into an 11-mer. The sequence of events is complicated, and is different for different chains.

Extended Data Fig. 4 Simulations for the scrambled sequence.

a, Comparison of fraction of RNA chains inside the droplets for (CAG)47 and the scrambled sequence at three different concentrations. Snapshots near the end of the simulations for the two sequences are shown. b, Droplet size evolution for the scrambled sequence (top) vs. (CAG)47 (bottom). Each horizontal line corresponds to a specific droplet in the system. The size is denoted by the colour (colour scale is on the right). c, Concentrations of the two phases for the scrambled sequence.

Extended Data Fig. 5 Effect of non-canonical bps.

Simulations for an isolated (CAG)47 monomer where non-canonical bps are allowed (purple), compared with the original model where there are only WC bps (orange). Shown on the left are histograms of the end-to-end distance Ree (top) and radius of gyration Rg (bottom). An intramolecular contact map is shown on the right. Some representative snapshots from the simulations are shown at the bottom.

Extended Data Fig. 6 Calibration of the bp interaction strength \({U}_{bp}^{o}\).

a, Structural dependence of a small CAG repeat sequence (AGGCAGCAGCCAAAAGGCAGCAGCCA) on \({U}_{bp}^{o}\). The sequence we chose to calibrate \({U}_{bp}^{o}\) is almost identical to the X-ray structure (PDB 3NJ6) (ref. 3), except with the addition of an AAAA tetraloop and two terminal A nucleotides. The sequence adopts extended conformations for small \({U}_{bp}^{o}\) (\({U}_{bp}^{o} < 4.5\) kcal mol−1), and folds into hairpin conformations in the bp interaction range, \(4.5 < {U}_{bp}^{o} < 6.0\) kcal mol−1. We set \({U}_{bp}^{o}=-5.0\) kcal mol−1. b, Root mean squared deviation (RMSD) between the simulations and the X-ray crystal structure, shown for \({U}_{bp}^{o}=-5.0\) kcal mol−1. The averaged value for RMSD is around 5 Å, which is reasonable given the coarse-grained nature of the model. c, Superposition of the simulated structure (yellow and grey beads) onto the X-ray structure for the lowest RMSD (around 1 Å).

Extended Data Fig. 7 Condensate formation does not depend on the cooling rate.

Fraction of chains in droplets or existing as oligomers/monomers. The vertical dashed lines indicate when the temperature is lowered (from 100∘C to 20∘C). Snapshots from left to right correspond to, respectively, the end of 80∘C, the end of the cooling period and the final state of the simulation.

Extended Data Fig. 8 Structures of isolated (CUG)n monomers.

Same as Extended Data Fig. 2, but for (CUG)n monomers. In addition to WC G-C base pairs, Wobble base pairs between G-U could also form. a, Distribution of the end-to-end distance Ree and b, radius of gyration Rg of (CUG)n with n=47, 31 and 20. The vertical dash lines in a indicate mean values for self-avoiding random walk chains with the same n. c, Bond–bond orientational correlation function cos θ (s) as a function of the sequence distance s. The inset shows average inter-nucleotide distances R(s) vs. s. The dashed line shows R(s) for a self-avoiding polymer (R(s) ∝ s0.588). At large s, there is an abrupt drop in R(s) because the two ends strongly interact with each other, thus bringing them to proximity. d, Contact map for (CUG)47 shows that the majority of interactions occur along the anti-diagonal, indicating the formation of hairpin structures.

Extended Data Fig. 9 Dissociation of RNA droplets at 150 mM NaCl.

The simulations were started from the final configuration obtained in the droplet simulation of 200μM of (CAG)47 (left). The repulsive electrostatic interactions between RNA nucleotides (due to the incomplete neutralization of phosphate charges) lead to the disassembly of the droplets, leaving only monomers and small oligomers (right).

Supplementary information

Supplementary Information

Supplementary Figs. 1–7.

Supplementary Video 1

Dynamics of phase separation in (CAG)47 from monomers to condensates. The monomer RNA concentration is 200μM. At the initial time (τ = 0), the chains exist as monomers. At intermediate times, oligomers form, which subsequently fuse together resulting in large droplets as time progresses. See Figures 1a, 3a, and 5 for the corresponding trajectories. Note that some of the individual RNA chains may look less helical shape due to trajectory-smoothing needed for easier visualization. The movie shows both fusion as well as fission of the droplets.

Supplementary Video 2

Growth and fusion of condensates. The movie shows two small clusters of RNA chains (green and magenta) fuse to form a droplet. In the process, the cluster in magenta is once partially dissolved but eventually coalesce with the other cluster (green).

Supplementary Video 3

Jamming dynamics of two labelled RNA chains inside a droplet. The movie shows the late-stage dynamics in a simulation trajectory at 200μM (CAG)47 after the formation of a large droplet. For clarity, focus is on two RNA chains shown in yellow and red colours, whereas all other chains in the same droplet are shown as transparent blue chains. The motions of these RNA chains are highly restricted, resulting in reptation dynamics (Fig. 7c).

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Nguyen, H.T., Hori, N. & Thirumalai, D. Condensates in RNA repeat sequences are heterogeneously organized and exhibit reptation dynamics. Nat. Chem. 14, 775–785 (2022). https://doi.org/10.1038/s41557-022-00934-z

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/s41557-022-00934-z

This article is cited by

Search

Advanced search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing