Abstract
Atherosclerosis (AS) is a chronic cardiovascular disease endangering human health and is one of the most common causes of myocardial infarction and stroke. Macrophage polarization plays a vital role in regulating plaque stability. As an important component of sunlight, ultraviolet B (UVB) has been proven to promote vitamin D and nitric oxide synthesis. This research used an AS model in ApoE−/− mice to study the effects of UVB on macrophage polarization and atherosclerotic plaque stability. In vitro, UVB irradiation increased arginase-I (Arg-I, M2 macrophage) and macrophage mannose receptor (CD206) expression, while the expression of inducible nitric oxide synthase (iNOS) (M1 macrophage) and CD86 was decreased. UVB promoted Akt phosphorylation in vitro. In vivo, UVB irradiation promoted the stabilization of atherosclerotic lesion plaques, while the phenotype of M2 macrophages increased. Our research provides new evidence for UVB in preventing and treating atherosclerosis.
Similar content being viewed by others
Introduction
Cardiovascular disease has the highest morbidity and mortality of all diseases in the world. Atherosclerosis (AS) is a long-lasting cardiovascular disease endangering human health, and it has become one of the most common causes of myocardial infarction and stroke. Abnormal lipid metabolism and inflammation are two key factors in the formation and progression of atherosclerotic plaques. AS is generally considered an inflammatory disease [1], as inflammation plays a vital role in all stages of the atherosclerotic process [2]. Studies have shown that immune cells such as macrophages are the main inflammatory cells, and they play a key role in causing chronic inflammation of the aortic wall and participate in the occurrence and development of AS [3]. Macrophage inflammation is a common basis of physiological and pathological changes during the initiation and development of AS [4].
It is generally believed that there are two types of macrophages: M1 macrophages and M2 macrophages. Interferon-gamma (IFN-ɣ) or lipopolysaccharide can activate M1 macrophages and interleukin (IL)-13 or IL-4 can activate M2 macrophages [5,6,7]. They play different roles in inflammation: M1 macrophages produce proinflammatory cytokines, such as IL-6, IL-1β, and tumor necrosis factor-α (TNF-α) and M2 macrophages produce anti-inflammatory cytokines, such as IL-10 [7,8,9]. The proinflammatory macrophage marker inducible nitric oxide synthase (iNOS) is expressed on M1 macrophages, and the anti-inflammatory macrophage marker arginase 1 (Arg1) is expressed on M2 macrophages [10]. Therefore, considering the proinflammatory effect of M1 macrophages and the anti-inflammatory effect of M2 macrophages, promoting the polarization of M2 macrophages may provide a new way to relieve inflammation and increase AS plaque stability.
As an important component of sunlight, ultraviolet B (UVB) has a wavelength range of 280–320 nm. Although UV exposure can cause several skin diseases, UVB light has been found to promote the production of vitamin D [11], melanin [12, 13], and nitric oxide [14]. In addition, UVB radiation has also been used to treat vitiligo [15], psoriasis [16], atopic dermatitis [17], eczema [18], and cutaneous T cell lymphoma [19]. Interestingly, UVB not only causes peripheral effects but is also related to various neurobehaviors. Recent studies have shown that learning and memory can be affected by UVB exposure [20]. In recent years, UVB exposure has been found to inhibit the formation of angiotensin II-induced abdominal aortic aneurysms in mice [21]. In former studies, researchers found that 10 and 50 mJ/cm2 UVB irradiation activated p42/44, p38, JNK, tyrosine kinase, and PI3K signaling pathways in macrophages in vitro [22]. It has also been suggested that ERK and Akt signaling pathways play important roles in macrophage M2 polarization [23, 24]. Considering that the polarization of macrophages plays an important role in AS and inflammation, we hypothesize that UVB may induce macrophages towards the anti-inflammatory M2 phenotype to protect against AS.
To test this hypothesis, we studied the anti-atherosclerotic effect of UVB treatment on atherosclerotic apolipoprotein E-deficient (ApoE−/−) mice in vivo. We also studied the possible pathways of peritoneal macrophages and human monocytic Tohoku Hospital Pediatrics-1 (THP1) cells in vitro under UVB irradiation.
Materials and Methods
Animals
Twenty-four 8-week-old male ApoE−/− mice were obtained from Charles River Laboratory (Beijing, China), and all mice were subjected to a 12-h light/12-h dark cycle. A high-fat diet (15% cocoa butter and 0.25% cholesterol) was fed to all mice in the following 16 weeks. Subsequently, the mouse backs were shaved and randomly divided into 2 groups (n = 12 per group) for treatment: the UVB group received UVB irradiation (G15T8E UVB lamp emits a continuous spectrum from 275 to 320 nm) of 25 mJ/cm2 (28 µW/cm2, 15 min) every other day (three times per week) for 4 weeks, and the control (CTR) group did not receive any treatment. The irradiation dose was determined on the basis of previous studies [25]. The irradiation was conducted at approximately 8:00 a.m. Mice were sacrificed after 4-week irradiation, and aortas and peritoneal macrophages were harvested. All animal protocols were approved by the Institutional Animal Care and Use Committee of Cheeloo College of Medicine, Shandong University (animal ethics number is KYLL-2021 (KS) -746).
Peritoneal Macrophage Extraction
Pre-cooled phosphate-buffered solution (PBS) (10 ml) was injected into the abdominal cavity of the mice, while the abdomen was kneaded softly for 2 min. The PBS was drawn out and collected, and then centrifuged for 10 min at 1000 rpm. The cells were cultivated in 24-well plates at 37 °C for 2 h until they had adhered, then the cultivation holes were washed with pre-cooled PBS. The adherent cells were peritoneal macrophages [26].
Cell Culture
THP1 cells resuspended in 1640 medium were placed into six-well plates, and phorbol 12-myristate 13-acetate (PMA) was added to the cells at 50 ng/ml [27] for 24 h, after which the UVB group cells received UVB irradiation of 25 mJ/cm2. The cells in the control group received no irradiation. Twenty-four hours after UVB irradiation, cells were obtained for flow cytometry and western blot analysis. For the Auto- ja Kuljetusalan Työntekijäliitto (Akt)-inhibited group, MK-2206 was added to the cells at 10 µM. The stimulus lasted 24 h.
ELISA Analysis
IL-6, IL-1β, and TNF-α levels in serum, culture supernatant of peritoneal macrophage, and THP1-induced M0 macrophages were determined via ELISA kits (EK106/2; EK101B; EK182; EK201B/3; EK206/3; EK282/3, Multisciences (Lianke) Biotech, Co., Ltd and R&D Systems) according to the manufacturer’s protocol. After the procedure, plates were read on a spectrometer at 450 nm and 570 nm wavelength. The results were converted to numeric values by using standard curves.
Flow Cytometry
For fluorescence-activated cell sorting analysis, 105 peritoneal macrophages or THP-1-induced M0 macrophages (CTR group and UVB group) were isolated and resuspended in 100 µl PBS, and antibodies were added to the corresponding cells. Flow cytometric analysis was performed by FACSCanto II (BD Biosciences) using Flow Jo software. The following antibodies were used: PE/Cyanine7 anti-human CD206 (BioLegend, 321,124), FITC anti-human CD86 (BioLegend, 374,204), APC anti-human CD163 (BioLegend, 333,609), PE/Cyanine7 anti-mouse CD86 (BioLegend, 105,014), FITC anti-mouse CD206 (BioLegend, 141,704), PE/Cyanine7 anti-mouse CD204 (Invitrogen, 2,263,083), and PE anti-mouse CD163 (BioLegend, 156,703).
Histopathological Staining
The aortas and hearts were taken immediately and fixed in 4% formaldehyde overnight. HE staining was used to calculate plaque area in aortic root. The dissected aortas and aortic roots were incubated with 0.5% oil red O staining solution at room temperature for 30 min, and then washed twice with purified water. Percentage of oil red O positive area in total aortic area and percentage of aortic root area were quantitatively analyzed by using Image-Pro Plus 6.0 (IPP 6.0, Media Cybernetics, Rockville, MD, USA). For histological staining, the aortic roots were embedded into the optimal cutting temperature (OCT) to make cryosections and cut into serial 6-μm cross-sections. Rabbit monoclonal antibodies against smooth muscle actin (ab5694; Abcam, USA) and rat anti-monocyte/macrophage antibodies [MOMA-2] (ab3345; Abcam, USA) were used for immunohistochemical (IHC). Horseradish peroxidase (HRP)-conjugated goat anti-rabbit, goat anti-rat, and goat anti-mouse secondary antibodies (ZSJB-BIO, China), were used in the sections incubated with primary antibodies. Picrosirius red staining was used to detect the lipid and collagen contents of the lesions. For each slide, at least three high-power field images were captured and evaluated in a blinded fashion. The slides were quantitatively analyzed by using IPP 6.0. The plaque vulnerability index was calculated according to the formula: vulnerability index = (lipid deposit% + macrophages%)/(collagen fibers% + SMCs%)[28].
Oil Red O Staining
Primary peritoneal macrophages were plated on cover slides in 24-well plates. Two hours later, cells were washed with PBS and new medium was added into cells. Then cells were divided into two groups: the CTR group and the UVB group. In UVB group, cells received 25 mJ/cm2 UVB irradiation. Then 75 µg/ml OX-LDL was added into two group cells. Twenty-four hours later, cells were washed with cold phosphate-buffered saline three times and fixed with 4% paraformaldehyde for 10 min. Subsequently, 0.5% oil red O was added to cells for 10 min. Of note, oil red O needs to be filtered to remove impurities. Foam cells were observed under a microscope at × 400 magnification.
Western Blotting
RIPA lysis buffer supplemented with a complete protease inhibitor cocktail was used to lyse cells on ice. Equal amounts of protein (10 µg) were separated with a 10% SDS-PAGE gel, and the protein was transferred to PVDF membranes (0.22 µm, Millipore). Membranes were obstructed in protein fast blocking fluid (EpiZyme, Shanghai, China) and incubated with primary antibodies against iNOS (ab129372; Abcam, Cambridge, USA), Arg-I (ab91279; Abcam), p-AKTser473 (4060, CST), p-AKTser308 (13038 T, CST), AKT (4685, CST), MCP-1 (81559, CST), IL-1β (12703, CST), IL-6 (12153, CST), and TNF-α (11948, CST). GAPDH (5174, CST) was used as CTR.
RT-PCR
Real-time PCR system detects mRNA expression. Total RNA was extracted from peritoneal macrophages using TRIzol reagent (Life Technologies). For reverse transcription (RT), a PrimeScript RT reagent kit (Takara, Shiga, Japan) was used. Quantitative PCR was performed as described previously using SYBR Premix Ex Taq (Takara) and a Roche Light Cycler 480 II instrument in a 96-well plate according to the manufacturer’s protocol. The following primers were used to amplify MCP-1, IL-6, IL-1β, TNF-α, and actin.
-
TNF-α-F: GCCACCACGCTCTTCTGTCT,
-
TNF-α-R: TGAGGGTCTGGGCCATAGAAC;
-
IL-6-F: ACAACCACGGCCTTCCCTAC,
-
IL-6-R: CATTTCCACGATTTCCCAGA;
-
IL-1β-F: ACCTTCCAGGATGAGGACATGA,
-
IL-1β-R: AACGTCACACACCAGCAGGTTA;
-
MCP1-F: TAAAAACCTGGATCGGAACCAAA,
-
MCP1-R: GCATTAGCTTCAGATTTACGGGT;
-
Actin-F: CCACACCCGCCACCAGTTCG,
-
Actin-R: TACAGCCCGGGGAGCATCGT.
Statistical Analysis
All data represent at least three different experiments. GraphPad Prism 5.0 (La Jolla, CA, USA) was used for statistical analysis. The values were presented as the mean ± SEM. Student’s t-test was used for two-group comparisons. p < 0.05 was considered significant.
Results
UVB Irradiation Decreased Aortic Plaque Area and Enhanced Atherosclerotic Plaque Stability
ApoE−/− mice were fed a high-fat diet for 16 weeks to study the effect of UVB irradiation on AS in vivo. Then, the mice were divided into two groups: the CTR group and the UVB group. Mice in the UVB group received 25 mJ/cm2 UVB irradiation every other day (three times per week) for 1 month. The results showed that UVB irradiation decreased the aortic plaque area (Fig. 1A and B), aortic root plaque area (Fig. 1C–G) and increased the stability of aortic root plaques (Fig. 1C, D, E, and F). The characteristics of atherosclerotic vulnerable plaques are macrophage infiltration and lipid accumulation, as well as a thin cap with less collagen and smooth muscle cells (SMCs) [29, 30]. We found that after UVB treatment, the plaque content of lipids and macrophages was significantly reduced, while the plaque content of collagen and SMCs was significantly increased. These results demonstrated the beneficial effect of UVB irradiation on atherosclerosis.
UVB Irradiation Decreased Body Weight and Inflammation But Did Not Alter the Lipid Level
We found that there was decreased body weight in the UVB group (Fig. 2A). We also detected the total cholesterol (TC), total triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) levels in mouse serum. The results showed that there were no differences between the UVB group and the CTR group (Fig. 2B). In the in vivo experiment, aortic inflammatory cytokine proteins, such as MCP-1, IL-6, and IL-1β, showed lower expression in the UVB group (Fig. 2C and D). There was decreased serum level of TNF-α, IL-1β, and IL-6 in UVB irradiation group (Fig. 2E–G).
UVB Induced M2 Macrophage Polarization and Decreased Peritoneal Macrophage Inflammatory Cytokine Expression In Vivo
To explore whether the mouse macrophage polarization switch is involved in the preventive effect of UVB on AS, we tested the peritoneal macrophages in the CTR group and the UVB group. The results showed that the proportion of M2 phenotype (CD206 + , CD163 + , CD204 +) cells in the UVB group was higher than that in the CTR group, and the proportion of M1 phenotype (CD86 +) cells in the UVB group was much lower than that in the CTR group, as determined by flow cytometry (Figs. 3A and B, 3C–D).
Correspondingly, UVB inhibited the inflammatory response of macrophages, which manifested as a significant decrease in the mRNA of proinflammatory cytokines such as IL-1β, IL-6, MCP-1, and TNF-α in peritoneal macrophages (Fig. 3E–H).
UVB Induced Macrophage M2 Polarization In Vitro
To explore the role of UVB in regulating the phenotype of macrophages in vitro, we induced THP1 cells into M0 macrophages with PMA. According to flow cytometry analysis, the percentage of M2 phenotype (CD206 + , CD163 +) cells in the UVB group was much higher than that in the CTR group, while the percentage of M1 phenotype (CD86 +) cells was much lower than that in the CTR group (Fig. 4A–E).
Correspondingly, UVB irradiation reduced the protein levels of MCP-1, IL-6, TNF-α, and IL-1β in THP1 cells (Fig. 5A–B). The expression of iNOS (M1 marker) and Arg-1 (M2 marker) was detected in UVB-treated or untreated M0 macrophages. We found that UVB inhibited the expression of iNOS, while the Arg-I and CD206 levels increased (Figs. 6A–C and 6G–H). UVB irradiation also decreased IL-1β, IL-6, and TNF-α expression in cell culture supernatant induced or not induced by OX-LDL in peritoneal macrophage cultured in vitro (Fig. 5C–H). Oil red O detection showed that UVB irradiation reduced macrophage foam cells induced by oxidized low-density lipoprotein (Fig. 6E–F). Therefore, these results showed that UVB can induce macrophages to acquire the anti-inflammatory M2 phenotype in vitro.
UVB Induced Macrophage M2 Polarization Through the Akt-Dependent Pathway
Previous studies have shown that the polarization of M2 macrophages is achieved by activating Akt [24, 31,32,33]. To study whether Akt is involved in UVB-induced polarization of M2 macrophages, we tested the phosphorylation level of Akt in M0 macrophages induced by PMA. The results showed that the level of p-Akt/Akt in the UVB group was significantly higher than that in the CTR group. In addition, the Akt1/Akt2/Akt3 inhibitor mk-2206 significantly reversed the UVB-induced polarization of M2 macrophages and inhibited the phosphorylation of Akt ser473 (Fig. 6A–D). There was no alteration of phosphorylation of Akt Thr308 (Fig. 6G–H). These results showed that UVB-induced polarization of M2 macrophages may through an Akt-dependent pathway.
Discussion
In this study, we confirmed that UVB promoted macrophage M2 polarization, inhibited the inflammatory response, and further promoted the stability of atherosclerotic plaques in ApoE−/− mice. The effects of UVB on the polarization of M2 macrophages are mainly achieved through Akt phosphorylation.
In recent years, people have discovered that sunlight exposure has many health benefits, including protecting us from cardiovascular diseases [34], autoimmunity [35], and obesity and diabetes [36]. As one of the components of sunlight, there are an increasing number of studies on the function of UVB. Ferguson et al. found that UVB exposure can regulate the response of pro-atherosclerotic T cells by expanding and enhancing the functional capacity of CD4 + foxp3 regulatory T cells, thereby inhibiting AS in atherosclerotic-prone mice [37]. We also found that UVB irradiation can reduce the area of atherosclerotic plaques, aortic root plaque area and increase the stability of plaques at the aortic root. We performed UVB irradiation for a short period of time, three times a week for 4 weeks. Studies have shown that the balance of macrophage phenotypes M1 and M2 plays a potential role in plaque stability. M1 leads to fragile plaques, and M2 leads to stable plaques. We showed that UVB could reduce the inflammatory response by distorting macrophage M2 polarization in vivo, and then we determined the vascular protective effect of UVB. In the aortic root plaque in the UVB treatment group, we observed decreased lipid accumulation, decreased macrophage infiltration, and increased collagen and SMCs, suggesting a decrease in the plaque vulnerability index.
In this study, we found that the UVB group mice had lower body weights. This is not the first time we observed this phenomenon. Hart et al. found that UV irradiation significantly reduces weight gain caused by diet [36]. They also found no differences in water, food intake, travel distance, energy expenditure, or respiratory quotient. Perhaps the mechanism of UVB in weight loss needs further research.
On the other hand, by culturing THP-1 cells to induce M0 macrophages in vitro, we found that UVB irradiation induces polarization of M2 macrophages. The results were confirmed by morphological observation, flow cytometry, and western blotting experiments. We further explored the potential mechanism by which UVB promotes the polarization of M2 macrophages in vitro. Akt phosphorylation plays an important role in macrophage polarization. However, the phosphorylation of Akt in M2 polarization is still controversial. The increase in p-Akt promotes M2 polarization of macrophages [31,32,33]. However, some studies have shown conflicting findings. Decreased p-Akt promotes polarization of M2 macrophages [38]. In our study, we found that an increase in Aktser473 phosphorylation levels promotes the polarization of M2 macrophages, but UVB did not alter phosphorylation of Akt-308 site. An Akt inhibitor (MK-2206 2HCL, Selleck) blocks the effect of UVB on the polarization of M2 macrophages. In Tu et al. study, they found that DNA-PKcs-mTORC2 association is required for UVB-induced Akt Ser-473 phosphorylation and skin keratinocytes survival, maybe this association is also required in THP1 cells. In the following research, we will conduct further exploration and verification [39].
In summary, UVB protected against atherosclerosis by promoting the polarization of M2 macrophages and limiting the inflammatory response in plaques, which was achieved by increasing the phosphorylation of Akt. Our research provides new experimental evidence for the possibility of UVB prevention and treatment of AS. Our results show that UVB light from sunlight has the potential to prevent and treat chronic disease at sites distant from irradiated skin.
References
Wolf, D., & Ley, K. (2019). Immunity and inflammation in atherosclerosis. Circulation Research, 124(2), 315–327. https://doi.org/10.1161/circresaha.118.313591
van Dijk, R. A., Engels, C. C., Schaapherder, A. F., Mulder-Stapel, A., Ten Dijke, P., Hamming, J. F., et al. (2012). Visualizing TGF-beta and BMP signaling in human atherosclerosis: A histological evaluation based on Smad activation. Histology Histopathology, 27(3), 387–96. https://doi.org/10.14670/HH-27.387
Dale, M. A., Ruhlman, M. K., & Baxter, B. T. (2015). Inflammatory cell phenotypes in AAAs: Their role and potential as targets for therapy. Arteriosclerosis, Thrombosis, and Vascular Biology, 35(8), 1746–1755. https://doi.org/10.1161/atvbaha.115.305269
Aziz, M. H., Cui, K., Das, M., Brown, K. E., Ardell, C. L., Febbraio, M., et al. (2017). The upregulation of integrin α(D)β(2) (CD11d/CD18) on inflammatory macrophages promotes macrophage retention in vascular lesions and development of atherosclerosis. The Journal of Immunology, 198(12), 4855–4867. https://doi.org/10.4049/jimmunol.1602175
Murray, P. J., Allen, J. E., Biswas, S. K., Fisher, E. A., Gilroy, D. W., Goerdt, S., et al. (2014). Macrophage activation and polarization: Nomenclature and experimental guidelines. Immunity, 41(1), 14–20. https://doi.org/10.1016/j.immuni.2014.06.008
Sharifi, L., Nowroozi, M. R., Amini, E., Arami, M. K., Ayati, M., & Mohsenzadegan, M. (2019). A review on the role of M2 macrophages in bladder cancer; pathophysiology and targeting. International Immunopharmacology, 76, 105880. https://doi.org/10.1016/j.intimp.2019.105880
Wang, Y., Smith, W., Hao, D., He, B., & Kong, L. (2019). M1 and M2 macrophage polarization and potentially therapeutic naturally occurring compounds. International Immunopharmacology, 70, 459–466. https://doi.org/10.1016/j.intimp.2019.02.050
Hirata, Y., Tabata, M., Kurobe, H., Motoki, T., Akaike, M., Nishio, C., et al. (2011). Coronary atherosclerosis is associated with macrophage polarization in epicardial adipose tissue. Journal of the American College of Cardiology, 58(3), 248–255. https://doi.org/10.1016/j.jacc.2011.01.048
Kumar, V. (2018). Targeting macrophage immunometabolism: Dawn in the darkness of sepsis. International Immunopharmacology, 58, 173–185. https://doi.org/10.1016/j.intimp.2018.03.005
Hu, X., Wang, H., Han, C., & Cao, X. (2018). Src promotes anti-inflammatory (M2) macrophage generation via the IL-4/STAT6 pathway. Cytokine, 111, 209–215. https://doi.org/10.1016/j.cyto.2018.08.030
DeLuca, H. F., & Plum, L. (2017). UVB radiation, vitamin D and multiple sclerosis. Photochemical & Photobiological Sciences, 16(3), 411–415. https://doi.org/10.1039/c6pp00308g
Brash, D. E. (2016). UV-induced melanin chemiexcitation: A new mode of melanoma pathogenesis. Toxicologic Pathology, 44(4), 552–554. https://doi.org/10.1177/0192623316632072
Jussila, A., Huotari-Orava, R., Ylianttila, L., Partonen, T., & Snellman, E. (2016). Narrow-band ultraviolet B radiation induces the expression of β-endorphin in human skin in vivo. Journal of Photochemistry and Photobiology B: Biology, 155, 104–108. https://doi.org/10.1016/j.jphotobiol.2016.01.007
Vaccaro, M., Irrera, N., Cutroneo, G., Rizzo, G., Vaccaro, F., Anastasi, G. P., et al. (2017). Differential expression of nitric oxide synthase isoforms nNOS and iNOS in patients with non-segmental generalized vitiligo. International Journal of Molecular Sciences, 18(12), 2533. https://doi.org/10.3390/ijms18122533
Arisi, M., Rossi, M. T., Fusano, M., Gualini, A., Tomasi, C., Moggio, E., et al. (2019). Clinical and spectrophotometric evaluation of skin photoadaptation in vitiligo patients after a short cycle of NB-UVB phototherapy. Dermatology, 235(6), 509–515. https://doi.org/10.1159/000502853
Morita, A. (2018). Current developments in phototherapy for psoriasis. Journal of Dermatology, 45(3), 287–292. https://doi.org/10.1111/1346-8138.14213
Christoffers, W. A., Coenraads, P. J., Svensson, Å., Diepgen, T. L., Dickinson-Blok, J. L., Xia, J., et al. (2019). Interventions for hand eczema. Cochrane Database of Systematic Reviews, 4(4), Cd004055. https://doi.org/10.1002/14651858.CD004055.pub2
Kemény, L., Varga, E., & Novak, Z. (2019). Advances in phototherapy for psoriasis and atopic dermatitis. Expert Review of Clinical Immunology, 15(11), 1205–1214. https://doi.org/10.1080/1744666x.2020.1672537
Motschenbacher, S., Buder, K., Goebeler, M., & Kerstan, A. (2012). Combined oral alitretinoin and narrowband UVB treatment of cutaneous T cell lymphoma: Favourable response after multiple ineffective systemic therapies. European Journal of Dermatology, 22(6), 803–804. https://doi.org/10.1684/ejd.2012.1857
Zhu, H., Wang, N., Yao, L., Chen, Q., Zhang, R., Qian, J., et al. (2018). Moderate UV exposure enhances learning and memory by promoting a novel glutamate biosynthetic pathway in the brain. Cell, 173(7), 1716–27.e17. https://doi.org/10.1016/j.cell.2018.04.014
Hayashi, T., Sasaki, N., Yamashita, T., Mizoguchi, T., Emoto, T., Amin, H. Z., et al. (2017). Ultraviolet B exposure inhibits angiotensin II-induced abdominal aortic aneurysm formation in mice by expanding CD4(+)Foxp3(+) regulatory T cells. Journal of the American Heart Association, 6(9), 7024. https://doi.org/10.1161/jaha.117.007024
Sodhi, A., & Sethi, G. (2003). Involvement of MAP kinase signal transduction pathway in UVB-induced activation of macrophages in vitro. Immunology Letters, 90(2–3), 123–130. https://doi.org/10.1016/j.imlet.2003.08.008
Mu, X., Shi, W., Xu, Y., Xu, C., Zhao, T., Geng, B., et al. (2018). Tumor-derived lactate induces M2 macrophage polarization via the activation of the ERK/STAT3 signaling pathway in breast cancer. Cell Cycle, 17(4), 428–438. https://doi.org/10.1080/15384101.2018.1444305
Zhang, W., Xu, W., & Xiong, S. (2011). Macrophage differentiation and polarization via phosphatidylinositol 3-kinase/Akt-ERK signaling pathway conferred by serum amyloid P component. The Journal of Immunology, 187(4), 1764–1777. https://doi.org/10.4049/jimmunol.1002315
Fell, G. L., Robinson, K. C., Mao, J., Woolf, C. J., & Fisher, D. E. (2014). Skin β-endorphin mediates addiction to UV light. Cell, 157(7), 1527–1534. https://doi.org/10.1016/j.cell.2014.04.032
He, K., Li, Y., Yang, K., Gong, J. P., & Li, P. Z. (2014). Effect of peroxisome proliferator-activated receptor γ on the cholesterol efflux of peritoneal macrophages in inflammation. Molecular Medicine Reports, 10(1), 373–378. https://doi.org/10.3892/mmr.2014.2200
Chanput, W., Mes, J. J., & Wichers, H. J. (2014). THP-1 cell line: An in vitro cell model for immune modulation approach. International Immunopharmacology, 23(1), 37–45. https://doi.org/10.1016/j.intimp.2014.08.002
Wen, H., Liu, M., Liu, Z., Yang, X., Liu, X., Ni, M., et al. (2017). PEDF improves atherosclerotic plaque stability by inhibiting macrophage inflammation response. International Journal of Cardiology, 235, 37–41. https://doi.org/10.1016/j.ijcard.2017.02.102
Nakashima, Y., Plump, A. S., Raines, E. W., Breslow, J. L., & Ross, R. (1994). ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree. Arteriosclerosis and Thrombosis, 14(1), 133–140. https://doi.org/10.1161/01.atv.14.1.133
Zhang, X., Liu, M. H., Qiao, L., Zhang, X. Y., Liu, X. L., Dong, M., et al. (2018). Ginsenoside Rb1 enhances atherosclerotic plaque stability by skewing macrophages to the M2 phenotype. Journal of Cellular and Molecular Medicine, 22(1), 409–416. https://doi.org/10.1111/jcmm.13329
Han, R., Gao, J., Zhai, H., Xiao, J., Ding, Y., & Hao, J. (2016). RAD001 (everolimus) attenuates experimental autoimmune neuritis by inhibiting the mTOR pathway, elevating Akt activity and polarizing M2 macrophages. Experimental Neurology, 280, 106–114. https://doi.org/10.1016/j.expneurol.2016.04.005
Wang, L., Wang, R., Chen, Z., Zhao, H., & Luo, Y. (2018). Xinnao shutong modulates the neuronal plasticity through regulation of microglia/macrophage polarization following chronic cerebral hypoperfusion in rats. Frontiers in Physiology, 9, 529. https://doi.org/10.3389/fphys.2018.00529
Rocher, C., & Singla, D. K. (2013). SMAD-PI3K-Akt-mTOR pathway mediates BMP-7 polarization of monocytes into M2 macrophages. PLoS ONE, 8(12), e84009. https://doi.org/10.1371/journal.pone.0084009
Sasaki, N., Yamashita, T., Kasahara, K., Fukunaga, A., Yamaguchi, T., Emoto, T., et al. (2017). UVB exposure prevents atherosclerosis by regulating immunoinflammatory responses. Arteriosclerosis, Thrombosis, and Vascular Biology, 37(1), 66–74. https://doi.org/10.1161/atvbaha.116.308063
Weller, R. B. (2016). Sunlight has cardiovascular benefits independently of vitamin D. Blood Purification, 41(1–3), 130–134. https://doi.org/10.1159/000441266
Hart, P. H., Norval, M., Byrne, S. N., & Rhodes, L. E. (2019). Exposure to ultraviolet radiation in the modulation of human diseases. Annual Review of Pathology: Mechanisms of Disease, 14, 55–81. https://doi.org/10.1146/annurev-pathmechdis-012418-012809
Ferguson, A. L., Kok, L. F., Luong, J. K., Van Den Bergh, M., Bell-Anderson, K. S., Fazakerley, D. J., et al. (2019). Exposure to solar ultraviolet radiation limits diet-induced weight gain, increases liver triglycerides and prevents the early signs of cardiovascular disease in mice. Nutrition, Metabolism, and Cardiovascular Diseases, 29(6), 633–638. https://doi.org/10.1016/j.numecd.2019.02.006
Liu, W., Yu, M., Xie, D., Wang, L., Ye, C., Zhu, Q., et al. (2020). Melatonin-stimulated MSC-derived exosomes improve diabetic wound healing through regulating macrophage M1 and M2 polarization by targeting the PTEN/AKT pathway. Stem Cell Research & Therapy, 11(1), 259. https://doi.org/10.1186/s13287-020-01756-x
Tu, Y., Ji, C., Yang, B., Yang, Z., Gu, H., Lu, C. C., et al. (2013). DNA-dependent protein kinase catalytic subunit (DNA-PKcs)-SIN1 association mediates ultraviolet B (UVB)-induced Akt Ser-473 phosphorylation and skin cell survival. Molecular Cancer, 12(1), 172. https://doi.org/10.1186/1476-4598-12-172
Funding
This work was assisted by the National Natural Science Foundation of China (81800775, 81600344, 82071939), Shandong Key Research and Development Program, China (2019GSF108276, 2019GSF108057, 2019GSF108013, 2019GSF108055, 2019GSF108242), Advanced Medical Research Institute Project (22480089398409), the Taishan Scholar Project of Shandong Province of China (tsqn20161066), the Natural Science Foundation for Distinguished Young Scholars of Shandong Province (ZR2020JQ30), China Postdoctoral Science Foundation (2018M642673 and 2018M640638), 81800775, and Shandong Provincial Natural Science Foundation, China (ZR2018BH010, ZR2016HQ29, ZR2020MH027).
Author information
Authors and Affiliations
Corresponding author
Ethics declarations
Ethics Approval
All applicable international, national, and/or institutional guidelines for the care and use of animals were followed.
This article does not contain any studies with human participants performed by any of the authors.
Conflict of Interest
The authors declare no competing interests.
Additional information
Associate Editor Junjie Xiao oversaw the review of this article.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Xin-Yun Li and Tao Qin are co-first authors.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Li, XY., Qin, T., Zhang, PF. et al. Weak UVB Irradiation Promotes Macrophage M2 Polarization and Stabilizes Atherosclerosis. J. of Cardiovasc. Trans. Res. 15, 855–864 (2022). https://doi.org/10.1007/s12265-021-10189-7
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1007/s12265-021-10189-7