Research PaperUncoupling protein 1-independent effects of eicosapentaenoic acid in brown adipose tissue of diet-induced obese female mice
Introduction
Obesity is a growing public health threat afflicting over 40% of US adults. It is linked to several comorbidities including type II diabetes, cardiovascular disease, and even some cancers [1], [2], [3]. Traditional anti-obesity strategies include dietary modification, increased physical activity, reinforcements through behavioral therapy [4], and in cases of severe obesity, medication or bariatric surgery are recommended [5, 6]. Increasingly, dietary supplements and bioactive foods are used to prevent or treat obesity [7,8].
The unique thermogenic properties of brown adipose tissue (BAT) make its activation an intriguing target for anti-obesity research, especially in light of the discovery of a functional BAT in adults [9]. The inner mitochondrial membrane of brown adipocytes contains uncoupling protein 1 (UCP1), a protein that uncouples oxidative phosphorylation from the synthesis of ATP by leaking protons across the mitochondrial membrane against their gradient [10]. This process, known as non-shivering thermogenesis, results in the production of heat and dispersion of energy, where UCP1 plays a critical role [11].
One method of activating non-shivering thermogenesis in BAT is chronic cold exposure, which stimulates norepinephrine release to activate the sympathetic nervous system [12]. Upon exposure to low temperature, cutaneous thermoreceptors such as transient receptor potential cation channel subfamily M member 8 (TRPM8) convey the sensation of cold to the hypothalamus [13]. Norepinephrine then transmits the efferent signal to BAT, activating β3-adrenergic receptors and inducing lipolysis to release free fatty acids [14]. Finally, the mitochondrial electron transport chain is activated and respiration is uncoupled via UCP1 [12,14].
In addition to cold temperature, activators of BAT thermogenesis include exercise and certain bioactive compounds [12]. We are specifically interested in omega-3 polyunsaturated fatty acids (ω-3 PUFA), which include both docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA). EPA is associated with metabolic improvements including anti-inflammatory, cardioprotective, and anti-obesity effects in rodents as well as triglyceride-lowering benefits in humans [15], [16], [17], [18]. Previous studies from our laboratory found that EPA supplemented along with high fat (HF) diet increased UCP1 and other thermogenic markers in BAT of diet-induced obese male mice compared to mice fed HF housed in an ambient environment [3].
When addressing mechanisms of BAT activation, an important consideration when designing studies related to obesity, and especially BAT, is the temperature at which animals are housed. For mice, the thermoneutral state is reached at approximately 28-30°C [19]. However, traditionally, studies using mouse models have housed their animals at ambient temperature (22-25°C), a condition that subjects mice to chronic thermal stress and forces them to increase their metabolism in order to compensate [20]. We recently reported that EPA protected against obesity and insulin resistance independently of UCP1 in male mice at thermoneutrality [21]. Further, sexual dimorphism and diet-specific impact exist for the thermogenic role of BAT ; hence, we tested whether female mice respond similarly to male mice [22]. Moreover, the mechanisms by which EPA activates BAT, including interactions with UCP1, remain incompletely understood. Herein, we evaluated the effects of EPA and UCP1 ablation on BAT in female mice living at thermoneutrality to test the hypothesis that beneficial effects of EPA on energy metabolism in female mice are independent of UCP1.
Section snippets
Genotyping
The Jackson Laboratory (Bar Harbor, ME) supplied heterozygous (HET) UCP1 C57BL/6J mice which were bred to yield homozygous WT and UCP1 knockout (KO) offspring. WT and UCP1 mutant primers were used to identify WT, KO, and HET genotypes. For the WT genotype, forward and reverse primer sequences were TCGTCATCAATAAGGGGAAAC and CTTCTTCCCTGATGCTCCAT respectively. For the KO genotype, GGTGTTTGGAGCCTGCATTGC and CTTCCTGACTAGGGGAGGAGT were used for forward and reverse sequences, respectively. DNA was
Effects of UCP1 deficiency and EPA on food intake, body weight, and body composition
Food intake was comparable among all groups (Fig. 1A). Only KO-HF mice had significantly higher body weight compared to all other groups (p < 0.05; Fig. 1B). KO mice fed EPA exhibited significantly reduced final body weight compared to KO-HF mice, but final body weight did not differ between the WT groups (p < 0.05; Fig. 2A).
There were no significant differences between interscapular BAT (Fig. 2B) and visceral adipose tissue (VAT)(Fig. 2C) among WT or KO groups. However, both the KO groups had
Discussion
Obesity is one of the greatest challenges faced by our society today, making research into the mechanisms of this disease and the development of novel anti-obesity therapies critical. In our research, we examined female mice housed at thermoneutrality to better understand how ω-3 fatty acids (EPA) reduce obesity through BAT activation in females. We focused on the metabolic effects of inactivation of UCP1, a protein responsible for the regulation of BAT thermogenesis which is located
Conclusion
Collectively, our findings support that ablation of UCP1 is detrimental to energy metabolism of female mice living at thermoneutrality. Moreover, we demonstrate that EPA's protective effects against diet-induced obesity and insulin intolerance in these animals are distinctly independent of UCP1.
These promising results should continue to drive mechanistic studies to explore adipose tissue-omega 3 fatty acids interactions at the molecular level and identify which alternative sex- and
Author Statement
Emily K Miller: Methodology, Investigation, Analyses, Visualization, Writing- First Draft of Manuscript
Mandana Pahlavani: Animal Experimentation, Methodology, Analyses, Visualization, Writing- Manuscript Editing & Review
Latha Ramalingam: Animal Experimentation, Analyses, Visualization, Writing-Editing and Review of Manuscript
Shane Scoggin: Animal and Molecular Experiments, Analyses, Training, Writing-Manuscript Review
Naima Moustaid-Moussa: Conceptualization, Study Design, Supervision,
Acknowledgements
This work was supported by NIH (NCCIH/NIA) award# R15 AT 8879-01A1.
References (57)
- et al.
Eicosapentaenoic acid regulates brown adipose tissue metabolism in high-fat-fed mice and in clonal brown adipocytes
The Journal Of Nutritional Biochemistry
(2017) - et al.
Mechanism of fatty-acid-dependent UCP1 uncoupling in brown fat mitochondria
Cell
(2012) - et al.
UCP1 in brite/beige adipose tissue mitochondria is functionally thermogenic
Cell Reports
(2013) - et al.
Dietary long-chain omega-3 fatty acids of marine origin: a comparison of their protective effects on coronary heart disease and breast cancers
Progress In Biophysics And Molecular Biology
(2006) - et al.
Eicosapentaenoic Acid Prevents and Reverses Insulin Resistance in High-Fat Diet-Induced Obese Mice via Modulation of Adipose Tissue Inflammation
The Journal of Nutrition
(2010) - et al.
Optimal housing temperatures for mice to mimic the thermal environment of humans: An experimental study
Molecular Metabolism
(2018) Thermal physiology of laboratory mice: Defining thermoneutrality
Journal of Thermal Biology
(2012)- et al.
A Structural Model of the Cytochrome c Reductase/Oxidase Supercomplex from Yeast Mitochondria
Journal of Biological Chemistry
(2007) - et al.
UCP1 ablation induces obesity and abolishes diet-induced thermogenesis in mice exempt from thermal stress by living at thermoneutrality
Cell Metabolism
(2009) - et al.
A creatine-driven substrate cycle enhances energy expenditure and thermogenesis in beige fat
Cell
(2015)
EPA prevents fat mass expansion and metabolic disturbances in mice fed with a Western diet
Journal of lipid research
Brown Adipose Tissue Exhibits a Glucose-Responsive Thermogenic Biorhythm in Humans
Cell Metabolism
n-3 fatty acids and serum lipoproteins: human studies
The American Journal of Clinical Nutrition
Fish oil supplementation and insulin sensitivity: a systematic review and meta-analysis
Lipids in health and disease
Effects of changes in fat, fish, and fibre intakes on death and myocardial reinfarction: diet and reinfarction trial (DART)
Lancet
Omega-3 fatty acids and metabolic syndrome: Effects and emerging mechanisms of action
Progress in Lipid Research
Differential effects of EPA, DPA and DHA on cardio-metabolic risk factors in high-fat diet fed mice
Prostaglandins, leukotrienes, and essential fatty acids
Eicosapentaenoic acid reduces adipocyte hypertrophy and inflammation in diet-induced obese mice in an adiposity-independent manner
The Journal of nutrition
Prevalence of Obesity Among Adults and Youth: United States, 2015-2016
NCHS data brief
The impact of obesity on US mortality levels: the importance of age and cohort factors in population estimates
American Journal Of Public Health
The prevention and treatment of obesity
Deutsches Arzteblatt international
The Challenge of Obesity Treatment: A Review of Approved Drugs and New Therapeutic Targets
J Obes Eat Disord
Advances in the Science, Treatment, and Prevention of the Disease of Obesity: Reflections From a Diabetes Care Editors' Expert Forum
Diabetes Care.
Anti-Inflammatory and Anti-Obesity Properties of Food Bioactive Components: Effects on Adipose Tissue
Preventive nutrition and food science
The effects of bioactive compounds on biomarkers of obesity
Functional Foods in Health and Disease
Unexpected evidence for active brown adipose tissue in adult humans
American Journal of Physiology-Endocrinology and Metabolism
Integrated control of brown adipose tissue
Heart and metabolism: management of the coronary patient
Cooling-Sensitive TRPM8 Is Thermostat of Skin Temperature against Cooling
PloS one
Cited by (6)
Temperature-Dependent Effects of Eicosapentaenoic Acid (EPA) on Browning of Subcutaneous Adipose Tissue in UCP1 Knockout Male Mice
2023, International Journal of Molecular SciencesCurcumin Stimulates UCP1-independent Thermogenesis in 3T3-L1 White Adipocytes but Suppresses in C2C12 Muscle Cells
2022, Biotechnology and Bioprocess Engineering
This work was supported by NIH (NCCIH/NIA) award# R15 AT 8879-01A1