Abstract
A micropore-filtration method was used to reduce the proportion of plant DNA in microbial DNA samples isolated from roots prior to sequencing. We tested the impact of this pre-sequencing filtration methodology and used it to characterize the root microbiome of maize grown on two soils with different fertility levels. The micropore filtration reduced plant DNA contamination and unveiled potential in the N-poor soil for N fixation in roots and phosphate uptake by roots in the phosphate-poor soil. Our methodology and findings allude to the potential capability of plants to initiate plant-microbe interactions under sub-optimal soil fertility.
Introduction
Micro-organisms exist in communities with several levels of interactions within and between microbial taxa (Cao et al. 2018). This has necessitated the advancement of microbiology research from single-microbe studies to community-level microbiome investigations (O’Malley and Skillings 2018). The insights gained from these microbiome studies include the observation of how a suppressive interaction between two microbes can be beneficial to the plant host (Fávaro et al. 2012; Tshikantwa et al. 2018). In fact, there are reports showing the potential benefits of the root-associated microbiome in maize under different environmental conditions (Beirinckx et al. 2020; Gomes et al. 2018).
Microbiome studies have benefited from the advancement in DNA sequencing technology that enabled the analysis of community-level interactions in a culture-independent manner (Hugenholtz et al. 1998; Jany and Barbier 2008; Su et al. 2012). Among the two major approaches used in DNA sequencing, whole-genome sequencing (metagenomics) and amplicon sequencing (metabarcoding), the latter that is cheaper and less-demanding on computing capacity involves the amplification of microbial marker genes like the 16S rRNA and ITS (internal transcribed spacer) for bacteria and fungi, respectively, and sequencing of the amplicons (Banchi et al. 2018; Lasa et al. 2019).
Amplicon sequencing has been used in several studies to identify microbial composition and abundance of the microbiota from different sources including plant roots (Beckers et al. 2016; Ma et al. 2020). The major limitation of such metabarcoding studies on plant microbiome is that the microbial marker genes share an evolutionary origin, and hence nucleotide sequences, with plant organelles, including mitochondria, chloroplasts, and other plastids (Hanshew et al. 2013). Therefore, the primers used to generate the amplicons, amplify DNA from both microbes and plants for sequencing, eventually limiting microbial identification (Zaheer et al. 2018). To circumvent this limitation, we used a pre-DNA-isolation filtration protocol aimed at reducing the proportion of plant cells in ground root tissues using a size discrimination filtration technique and evaluated its efficacy in the characterization of maize root microbiome.
Materials and methods
Planting and sample collection
Maize (cv. NK Falkone) was grown in 0.5 L pots containing two soil types, Soil_A—from an experimental station, and Soil_B—an agricultural soil. The main properties of soil A were sand 7%; silt 63%; clay 23%; pH 7.2; organic C 1.9%; total N 2140 mg/kg; and available P 0.3%. The main properties of soil B were sand 43%; silt 40%; clay 13%; pH 5.9; organic C 1.3%; total N 1240 mg/kg; and available P 0.6%. Seeds sown directly into the pots germinated within 4 to 6 days post-planting and were subsequently grown for 3 weeks under greenhouse conditions of 16/8 h day/night and 27/21 °C day/night temperature from March to April 2019. Five pot-replicates per soil were used and each pot contained 3 plants. The plant roots were harvested at the V3–V4 stages (3 to 4 true leaves) and carefully but thoroughly washed in phosphate-buffered solution (PBS: 5.8 mM Na2HPO4•7H2O + 4.2 mM NaH2PO4•H2O + sterile water until a volume of 1 L) to remove any rhizosphere soil. Root samples were collected on ice and stored at −80 °C until DNA isolation.
Sample processing and DNA isolation
Roots were ground in liquid nitrogen with mortar and pestle, and DNA was directly extracted from ~100 mg of the 5 replicates per soil using the QIAGEN DNeasy PowerSoil kit according to the manufacturer’s specification. Also, 4.5 g of the ground root tissue from each of the 5 replicates per soil was thawed in 25 mL PBS and shaken vigorously to form a homogenous suspension (see Supplementary Fig. S1). To get rid of plant cells, which are generally larger than microbial cells, a 144 cm2 piece of sterilized Miracloth (pore size 22 μm) folded into eight layers and trimmed to a dimension of 3 cm × 3 cm was inserted into a disassembled 50-mL syringe using a sterilized pair of forceps until the nozzle-base of the syringe was sealed by the Miracloth. The ground root in PBS suspension was subsequently carefully applied on the Miracloth and pressed through the Miracloth using the syringe piston. The filtrate was then centrifuged at 8500 g in a Hettich Rotina 420R refrigerated centrifuge for 20 min at 4 °C. The supernatant was discarded and the sediment containing mainly microbial cells was used for DNA isolation using the QIAGEN DNeasy UltraClean Microbial Kit according to the manufacturer’s specification. A microbial kit was used instead of PowerSoil kit to avoid DNA shredding of the microbes which could occur if PowerSoil kit is used since there is no microbial cell protection by soil or plant root particles. The PowerSoil kit and Microbial kit are from the same manufacturer and employ the same technique in DNA extraction. DNA yield was measured using a NanoDrop ND1000 spectrophotometer.
Metabarcoding and data analyses
For identification and quantification of bacterial and fungal communities, the bacterial 16S ribosomal RNA gene and fungal ITS genes were PCR-amplified using the following degenerate primers: V3-V4 (341f-806bR) primers for 16S (5′-3 ′, forward: CCTACGGGAGGCAGCAG; reverse: GGACTACHVGGGTWTCTAAT) (Takahashi et al. 2014) and ITS1f-lTS2 for fungal ITS (5′-3′, forward: CTTGGTCATTTAGAGGAAGTAA; reverse: GCTGCGTTCTTCATCGATGC) (Ihrmark et al. 2012). As a check for possible DNA contamination in the above protocols, ZymoBIOMICS microbial community standards were included in the workflow as both positive and negative controls. Following DNA amplification using AccuStart II PCR ToughMix (55 °C/33 PCR cycles) and library preparation, Illumina MiSeq sequencing was used for paired-end sequencing of the amplicons with read lengths of 300bp.
DADA2 and Phyloseq packages were used to analyze the sequenced reads (McMurdie and Holmes 2013; Callahan et al. 2016). Briefly, forward- and reverse reads were trimmed based on Phred read quality score threshold of 30 allowing 290bp and 250bp of forward and reverse reads, respectively for reads overlap. ITS reads were not trimmed to avoid losing relevant information. ITS databases like UNITE provide a good coverage of fungal taxa although many of the sequences may not be identified to specific taxa in comparison to the LSU (large subunit) marker gene which in turn may affect alpha diversity (Xue et al. 2019). After de-noising sequencing errors using predicted and observed error rates, the forward and reverse reads were merged to infer sequence variants. Chimeric sequences were removed using the consensus method and the SILVA reference (release 132) was used for taxonomic assignment. The read counts per sequence variant were normalized using rarefy_even_depth of Phyloseq R package to account for sequencing depth bias. However, for differential abundance computation using DESeq2, raw reads were converted into a DESeq object using phyloseq_to_deseq2 function and DESeq2 was used for the normalization of library depth. Statistical significance of the pre-treatment effects was tested with an analysis of deviance using the manyglm function of mvabund package, based on 5000 bootstrap iterations (Wang et al. 2012), whereas the difference in reads assignment was tested with simple ANOVA in R studio version 3.6
Results
Sequenced reads assignment and sequencing depth
The proportions of sequenced reads from plant organelles and microbial 16S or ITS were investigated. Plant reads were identified and sorted out as belonging to the order “Chloroplast” and/or family, “Mitochondria”. In the filtered samples, more reads were sequenced from bacterial 16S amplicons than from plant organelles, unlike in unfiltered samples (Fig. 1). Fungal ITS sequencing, as expected, did not pick up plant sequences (data not shown), but could be used to assess the impact of the protocol on off-target microbes. Furthermore, the numbers of sequenced reads were generally higher in the filtered than unfiltered samples (Table 1), probably due to random sequencing bias. The proportion of 16S reads assigned to bacterial species (Amplicon Sequence Variants, ASVs) were significantly higher in filtered samples than in the unfiltered, whereas there was no effect on the ITS reads (Table 1). The significantly higher percentage of assigned ITS reads compared to the 16S may be linked to the use of untrimmed ITS sequences in the analysis or the better coverage of fungal diversity in the UNITE database by our sequencing depth than bacterial diversity. To eliminate possible sequencing depth biases, only normalized assigned counts were used for downstream analyses.
Principal coordinate analysis (PCoA) of distance relationships among samples with Bray-Curtis metrics based on the normalized read counts showed that there is a significantly higher variation among the unfiltered samples than the filtered samples for 16S sequences (Supplementary Fig. S2a, b). Furthermore, analyses of deviance showed that for the 16S normalized read counts, both soil type and micropore filtration pre-treatment, significantly affected the amplicon sequence variants (ASVs) (Supplementary Table ST1), but no effect was detected on fungal (ITS) ASVs (data not shown). Rarefaction curves showed indeed that filtered samples had more sequencing depth and species abundance than the unfiltered samples for bacterial (16S) but not fungal (ITS) read counts (Supplementary Fig. S2c, d).
Root microbial abundance
Microbial abundance plots showed that filtered samples in both soil types recorded significantly more bacterial ASVs with less variations than unfiltered samples (Fig. 2a, b). But there was no effect on fungal abundance (Fig. 2c). However, these abundance plots did not show a significant difference in microbial abundance between Soil_A and Soil_B. Nonetheless, there was more overlap of assigned ASVs between treatments than between soils, suggesting that the pre-treatment did not negatively impact on the identification of microbes; rather, it improved the number of ASVs that could be identified (Fig. 2d, e).
Identification and differential abundance of root microbial composition
We compared the treatment approaches in terms of differential microbial abundance so as to ascertain the best approach for analyzing the differences in microbial abundance and composition between soils. In the root microbiome recruited in Soil_A, 24 bacterial ASVs were differentially more abundant in filtered than in unfiltered samples at p<0.01, while 8 ASVs were differentially more abundant even at p<0.001 with zero read counts in unfiltered samples (Supplementary Fig. S3.1). In Soil_B, four bacterial ASVs were differentially more abundant in filtered samples versus the unfiltered treatment; and in one instance, an ASV was more abundant in unfiltered samples (Supplementary Fig. S3.1). Fungal abundance was, however, not differentially affected (data not shown).
A comparison of the fungal and bacterial phyla abundances between roots from the two soils shows some differences although further studies would be required to confirm these observations. Firstly, there are 24 folds more non-annotated fungi detected in Soil_B than Soil_A suggesting the existence of more fungal diversity in Soil_B (Supplementary Fig. S3.2). Ascomycota was the most abundant fungal phylum in both soils, whereas Glomeromycota that includes arbuscular mycorrhizal fungi (AMF) was more abundant in roots of Soil_A than Soil_B. For bacterial abundance, Proteobacteria and Bacteroidetes were the most abundant phyla in roots from both soils (Supplementary Fig. S3.2). Generally, both soils showed a higher abundance of fungal phyla than bacteria.
There were 84 bacterial ASVs more abundant in roots from Soil_A when compared to Soil_B, whereas 71 bacterial ASVs (including Rhizobium) were more abundant in Soil_B roots compared to those in Soil_A (Supplementary Fig. S3.3). Among the fungal ASVs, 92 genera were differentially more abundant in roots of Soil_A than in Soil_B, whereas 73 genera were differentially more abundant in roots of Soil_B than in Soil_A (Supplementary Fig. S3.4). Interestingly, differentially abundant AMF including Funneliformis, Dominikia and Rhizophagus were found only in roots of Soil_A and not in Soil_B.
Discussion
Unravelling plant microbiome through DNA sequencing is challenging as a precaution is required to avoid plant DNA interference with microbial sequencing depth (Beckers et al. 2016; Fricker et al. 2019). Previous studies tackling this challenge compared several primers for their specificity in amplifying bacterial DNA (Beckers et al. 2016; Hanshew et al. 2013). The forward primers, 799F and its derivatives, emerged from these studies as the most specific for reducing plant plastid contamination. However, the coverage of the bacterial diversity by 799F (79.7%) is limited when compared with the coverage by 341F (91.2%) that we used in our study (Beckers et al. 2016). Interestingly, the plant DNA sequence contamination range in Beckers et al. (2016) with 341F primer is between 40 and 91% depending on the reverse primer combination, while with our micropore-filtration protocol, the plant DNA contamination was reduced to 30–40% (Fig. 1). This improvement suggests that efforts in selecting applicable primer pair combinations can be further boosted when combined with our filtration protocol.
To our knowledge, the only publication of efforts to reduce plant organelle contaminants prior to DNA isolation and sequencing is a Nycodenz gradient-based separation technique (da Cunha 2016). The Nycodenz separation approach is intended to obtain uncontaminated bacterial cells, but fungal cells are also lost in the process. This means that an extra DNA isolation is required to capture the fungal component in microbiome studies. In our protocol, however, the same micropore filtrate was used to extract both bacterial and fungal DNA for sequencing. Importantly, our protocol did not alter the outcome of the fungal ITS sequencing (Supplementary Fig. S2, Table 1). Furthermore, the total number of sequenced reads (Table 1) and reads mapping to bacteria (Fig. 1) showed that our filtration protocol did not lead to any losses of microbial data. This is logical because the filtration system allows sufficient room for microbial cells to be collected in the filtrate while filtering out significant proportion of plant material.
For application purposes, in plant microbiome profiling, the results from our new protocol show the importance of microbial read depth in computing the composition and differential abundance of microbes, especially bacteria (Supplementary Fig. S3.1). For instance, eight bacterial species could be detected in roots of Soil_A and four in roots of Soil_B only by the filtration pre-treatment (Supplementary Fig. S3.1). Additionally, the plant system, Zea mays, on which we tested our protocol in two soils suggests that this methodology has a potential for use in investigating plant-microbe interactions in different soils, but this needs further studies in more plant systems and soil types. Among the observations from our limited test system are the abundance of Rhizobium species in the N-poor soil (Supplementary Fig. S3.3), and the presence of arbuscular mycorrhizal fungi (AMF) in the phosphate-poor soil (Supplementary Fig. S3.4), pointing to the potential for initiation of plant root interaction with microbes under nutrient deficiency (Cocking et al. 1994; Rosenblueth et al. 2018; Cotton et al. 2019; Kobae 2019).
In conclusion, we demonstrate here the importance of filtering-out plant cells before DNA extraction in microbiome studies, and the implementation of that in understanding plant response to sub-optimal soil fertility. The protocol, in our view, has a large application potential, for research in ecology, agriculture and biodiversity. A scaled-up production of syringes with an inbuilt-filtration system as described here, would facilitate the routine implementation of this protocol in plant microbiome studies.
Data availability
Sequence data is archived at NCBI Genbank (accession number [to be provided])
Code availability
Not applicable
References
Banchi E, Ametrano CG, Stanković D, Verardo P, Moretti O, Gabrielli F, Lazzarin S, Borney MF, Tassan F, Tretiach M, Pallavicini A, Muggia L (2018) DNA metabarcoding uncovers fungal diversity of mixed airborne samples in Italy. PLoS One 13:e0194489. https://doi.org/10.1371/journal.pone.0194489
Beckers B, Op De Beeck M, Thijs S, Truyens S, Weyens N, Boerjan W, Vangronsveld J (2016) Performance of 16s rDNA primer pairs in the study of rhizosphere and endosphere bacterial microbiomes in metabarcoding studies. Front Microbiol 7:650. https://doi.org/10.3389/fmicb.2016.00650
Beirinckx S, Viaene T, Haegeman A, Debode J, Amery F, Vandenabeele S, Nelissen H, Inze D, Tito R, Raes J, De Tender C, Goormachtig S (2020) Tapping into the maize root microbiome to identify bacteria that promote growth under chilling conditions. Microbiome 8:54. https://doi.org/10.1186/s40168-020-00833-w
Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP (2016) DADA2: High-resolution sample inference from Illumina amplicon data. Nature Meth 13:581–583. https://doi.org/10.1038/nmeth.3869
Cao X, Zhao D, Xu H, Huang R, Zeng J, Yu Z (2018) Heterogeneity of interactions of microbial communities in regions of Taihu Lake with different nutrient loadings: a network analysis. Sci Rep 8:8890. https://doi.org/10.1038/s41598-018-27172-z
Cocking EC, Batchelor CA, Kothari SL, Jain S, Webster G, Jones J, Jotham J, Davey MR (1994) Cereal symbiotic nitrogen fixation : the interaction of Rizobia with cereals for symbiotic nitrogen fixation. In: Clément G, Cocking EC (eds) FAO MedNet Rice: Breeding and Biotechnology Groups: Proceedings of the Workshops. CIHEAM: Cahiers Options Méditerranéennes 8, Montpellier, France, pp 67–72
Cotton TEA, Pétriacq P, Cameron DD, Meselmani MA, Schwarzenbacher R, Rolfe SA, Ton J (2019) Metabolic regulation of the maize rhizobiome by benzoxazinoids. ISME J 13:1647–1658. https://doi.org/10.1038/s41396-019-0375-2
da Cunha VC (2016) Volatile-mediated interactions in the rhizosphere. Wageningen University Retrieved from https://edepot.wur.nl/388360
Fávaro LCL, Sebastianes FLS, Araújo WL (2012) Epicoccum nigrum P16, a Sugarcane endophyte, produces antifungal compounds and induces root growth. PLoS One 7:e36826. https://doi.org/10.1371/journal.pone.0036826
Fricker AM, Podlesny D, Fricke WF (2019) What is new and relevant for sequencing-based microbiome research? A mini-review. J Adv Res 19:105–112. https://doi.org/10.1016/j.jare.2019.03.006
Gomes EA, Lana UGP, Quensen JF, De Sousa SM, Oliveira CA, Guo J, Guimarães LJM, Tiedje JM (2018) Root-associated microbiome of maize genotypes with contrasting phosphorus use efficiency. Phytob J 2:129–137. https://doi.org/10.1094/PBIOMES-03-18-0012-R
Hanshew AS, Mason CJ, Raffa KF, Currie CR (2013) Minimization of chloroplast contamination in 16S rRNA gene pyrosequencing of insect herbivore bacterial communities. J Microbiol Methods 95:149–155. https://doi.org/10.1016/j.mimet.2013.08.007
Hugenholtz P, Goebel BM, Pace NR (1998) Impact of culture-independent studies on the emerging phylogenetic view of bacterial diversity. J Bacteriol 180:4765–4774. https://doi.org/10.1128/jb.180.24.6793-6793.1998
Ihrmark K, Bödeker ITM, Cruz-Martinez K, Friberg H, Kubartova A, Schenck J, Strid Y, Stenlid J, Brandström-Durling M, Clemmensen KE, Lindahl BD (2012) New primers to amplify the fungal ITS2 region - evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiol Ecol 82:666–677. https://doi.org/10.1111/j.1574-6941.2012.01437.x
Jany JL, Barbier G (2008) Culture-independent methods for identifying microbial communities in cheese. Food Microbiol 25:839–848. https://doi.org/10.1016/j.fm.2008.06.003
Kobae Y (2019) Dynamic phosphate uptake in arbuscular mycorrhizal roots under field conditions. Front Env Sci 6:159. https://doi.org/10.3389/fenvs.2018.00159
Lasa AV, Fernández-González AJ, Villadas PJ, Toro N, Fernández-López M (2019) Metabarcoding reveals that rhizospheric microbiota of Quercus pyrenaica is composed by a relatively small number of bacterial taxa highly abundant. Sci Rep 9:1695. https://doi.org/10.1038/s41598-018-38123-z
Ma H, Pineda A, Hannula SE, Kielak AM, Setyarini SN, Bezemer TM (2020) Steering root microbiomes of a commercial horticultural crop with plant-soil feedbacks. Appl Soil Ecol 150:103468. https://doi.org/10.1016/j.apsoil.2019.103468
McMurdie PJ, Holmes S (2013) Phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLoS One 8:e61217. https://doi.org/10.1371/journal.pone.0061217
O’Malley MA, Skillings DJ (2018) Methodological strategies in microbiome research and their explanatory implications. Perspect Sci 26:239–265. https://doi.org/10.1162/POSC_a_00274
Rosenblueth M, Ormeño-Orrillo E, López-López A, Rogel MA, Reyes-Hernández BJ, Martínez-Romero JC, Reddy PM, Martínez-Romero E (2018) Nitrogen fixation in cereals. Front Microbiol 9:1974. https://doi.org/10.3389/fmicb.2018.01794
Su C, Lei L, Duan Y, Zhang KQ, Yang J (2012) Culture-independent methods for studying environmental microorganisms: methods, application, and perspective. Appl Microbiol Biotechnol 93:993–1003. https://doi.org/10.1007/s00253-011-3800-7
Takahashi S, Tomita J, Nishioka K, Hisada T, Nishijima M (2014) Development of a prokaryotic universal primer for simultaneous analysis of Bacteria and Archaea using next-generation sequencing. PLoS One 9:e105592. https://doi.org/10.1371/journal.pone.0105592
Tshikantwa TS, Ullah MW, He F, Yang G (2018) Current trends and potential applications of microbial interactions for human welfare. Front Microbiol 9:1156. https://doi.org/10.3389/fmicb.2018.01156
Wang Y, Naumann U, Wright ST, Warton DI (2012) Mvabund- an R package for model-based analysis of multivariate abundance data. Methods Ecol Evol 3:471–474. https://doi.org/10.1111/j.2041-210X.2012.00190.x
Xue C, Hao Y, Pu X, Ryan PC, Wang Q, Zhao M, Zhang B, Ran W, Huang Q, Shen Q, Tiedje JM (2019) Effect of LSU and ITS genetic markers and reference databases on analyses of fungal communities. Biol Fertil Soils 55:79–88
Zaheer R, Noyes N, Ortega PR, Cook SR, Marinier E, Domselaar VG, Belk KE, Morley PS, McAllister TA (2018) Impact of sequencing depth on the characterization of the microbiome and resistome. Sci Rep 8:5890. https://doi.org/10.1038/s41598-018-24280-8
Acknowledgements
We appreciate the following for their advice and recommendations: Dr. Desalegn Etalo, Dr. Benjamin Thiombiano, Dr. Anouk Zancarini, and Syngenta AG Staff members for assistance with sample collection.
Funding
This work was funded by Syngenta Crop Protection.
Author information
Authors and Affiliations
Contributions
HJB, TM, and EBA designed the experiment and acquired the data; EBA and WT processed and analyzed the data; HJB, TM, and EBA wrote the manuscript; all authors gave final approval for publication.
Corresponding author
Ethics declarations
Ethics approval
Not applicable
Consent to participate
Not applicable
Consent for publication
All authors have given their consent for this publication.
Conflict of interest
The authors declare no competing interests.
Additional information
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Supplementary Table 1
(DOCX 15 kb)
Supplementary Figure 1
(DOCX 377 kb)
Supplementary Figure 2
(DOCX 221 kb)
Supplementary Figure 3
(DOCX 74 kb)
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Aliche, E.B., Talsma, W., Munnik, T. et al. Characterization of maize root microbiome in two different soils by minimizing plant DNA contamination in metabarcoding analysis. Biol Fertil Soils 57, 731–737 (2021). https://doi.org/10.1007/s00374-021-01555-3
Received:
Revised:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1007/s00374-021-01555-3