Microfluidic chip fabrication and performance analysis of 3D printed material for use in microfluidic nucleic acid amplification applications

Photo-curable resins are typically acrylate and/or epoxy derived monomer and oligomer formulations that are cross-linked upon exposure to ultraviolet (UV) light [20, 22]. Monomers and oligomers are highly cytotoxic for most types of mammalian cells [23] and PCR inhibiting [24, 25]. These can leach from the printed polymer and interfere with vital biochemical reactions in a biological process, such as cell proliferation and differentiation [26] and enzymatic nucleic acid amplification [25]. Biological compounds can further interfere with the printed surface leading to their adsorption. In high SVR microfluidic architectures, surface interactions can have detrimental effect in the outcome of a reaction. Basic post-processing protocols for photopolymer prints include solvent washes, thermal and post-UV curing, with all approaches aiming to reduce print residuals [27]. Appropriate post-processing of resin prints has been shown in multiple cases to enable applications such as cell and bacteria culture [26, 28–30] and PCR [24, 31, 32]. Furthermore, commercially available biocompatible (USP Class IV) SLA resins have been tested in low-risk applications such as skin and internal tissue contact for hearing aids and dental inserts, short period bacteria and/or cell cultivation experiments [33, 34]. Highly biocompatible and biodegradable photo-curable formulations for tissue engineering applications have also been reported [35–39]. The intrinsic reactivity of photopolymers further enables static or dynamic coating of various biocompatible agents on 3D printed channels to improve performance. Coating agents such as silanes [4], polyethylene glycol (PEG) [31, 40], serum albumin (BSA) [31, 41], polyvinylpyrrolidone, hydroxyethylcellulose [42], polyvinyl alcohol [31] and formaide [4] have all been shown to reduce non-specific adsorption and facilitate cell and PCR compatibility in conventionally and additively manufactured PCR devices, including photopolymer prints [31].

The minimum feasible size of a monolithic microchannel printed in SLA is determined by part orientation, channel pattern and resin viscosity [43], along with the print resolution as defined by laser beam (SLA) or pixel size in case of Digital Light Processing (DLP) SLA technology.

The current mature 3D printing methods with SLA cannot realise very complex patterns, as uncured resin cannot be efficiently removed from complex microchannels. Hence, 3D printed microfluidics often display limited functionality [21]. Even with low viscosity resins, drainage issues limit design freedom, while most heat resistant SLA resins for thermal cycling applications are high viscosity, due to the high molecular weight monomers and oligomers content. Design for drainage practices, optimum model orientation [44], channel feasibility studies and low viscosity resins [15, 45] are some techniques that partially address this issue, although compromise design flexibility. To realise enclosed channels, different groups employed multi-step printing practices [31, 46, 47]. For instance, Hutchinson et al reported the use of sacrificial wax for layer-by-layer photolithographic patterning of photo-definable monomer [47]. The process was manually performed layer-by-layer and is mentioned as contact liquid photolithographic polymerization (CLiPP). Elements of it were patented in 2003 [48]. Yin et al established specific protocols to remove sacrificial wax from inkjet-3D printed channels in complex 2D patterns [49], a protocol that was subsequently employed for printing droplet-based PCR chips [32]. To circumvent resin drainage issues, Büttner et al demonstrated a single layer exposure method based on DLP projection for printing complex channels with heights of 25–150 μm on polymethyl methacrylate (PMMA) or glass substrates [46]. Another recent work on manufacturability of microfluidics with DLP SLA was demonstrated by Bazaz et al [50]. The group printed open channel microfluidic parts which were then bonded on PMMA sheets with pressure sensitive tape. In this way, the group produced various inertial microfluidic devices with application in particle and cell separation. In other work, Kadimisetty et al [31] designed and printed two separate microfluidic parts with SLA to assemble them into a micro-reactor array for isothermal nucleic acid amplification. The two-part assembly enabled the integration of membranes for DNA extraction, while offered sufficient convenience for resin drainage after printing. Ruiz et al used a hybrid SLA–FDM (Fused Deposition Modelling) printing approach to print polymethacrylate-thermoplastic polyurethane elastomer devices. Polyurethane elastomer provided leak-free bonding and pumping functionality [51]. The works of Hutchinson et al [47] and Yin et al [49] produced successful results in context of manufacturability for complex channels with sacrificial material. However, similar approaches with sacrificial material has not been seen for the lower-cost DLP SLA. Different approaches to print enclosed microfluidics with DLP SLA [46, 50, 51] have produced successful results in their field of applications, however the main drawback lies on the use of adhesives sheets that introduce material inconsistency in the channels and impose multi-step processing.

Improvements in the 3D printing technology and materials is anticipated to yield further advancements in several research fields, including microfluidics [52, 53]. It has been argued that with proper bonding methods and successful addressing of the biocompatibility factor, resin-based 3D printing displays great potential as prototyping techniques for lab-on-chip platforms [30, 54, 55]. Yet, specific, standardized and scalable processing protocols, manufacturability issues, repeatability of prints, integration and performance of 3D printed devices in key microfluidic case studies are not developed in detail [53, 56, 57].

Towards this end, this paper reports on novel process optimisation techniques in the creation of monolithic microfluidic channels and geometries for PCR thermocycling using SLA. To deliver enclosed serpentine microchannels with DLP SLA, a two-stage printing method was developed and assessed in printing of several replicates of an oscillating-flow microfluidic geometry for two-step PCR thermocycling. The suggested printing method employs sacrificial wax, which enabled complex channel patterns that are not feasible at a single print step. The effect of the post-processed material in PCR was assessed by mock PCR reactions and quantitative PCR (qPCR) analysis of leachates from printed chips, retrieved from simulated thermocycling experiments on a custom-built thermocycler. To improve material performance, PEG and silane coatings were developed as dip-coating methods, evaluated, and implemented as perfusion coatings in 3D printed chips. Leachates from functionalized chips were assessed in qPCR and compared to those retrieved from non-treated chips. The efficiency of printing, post-processing and surface treatments are discussed and the overall potential of DLP SLA to advance the microfluidics field is summarized.

Printing experiments were performed on an Autodesk Ember commercial DLP SLA 3D printer. The system projects high-definition patterns in 405 nm (27.5 mJ cm⁻²) UV light with a 50 μm pixel resolution on a maximum build area of 64 × 40 mm. Layer height (z) resolution was 50 μm. To print the mock PCR specimens and PCR chips, Formlabs Hi Temp SLA resin was selected, due to its high temperature resistance and good optical transparency. According to manufacturer, the printed and post-UV-cured parts exhibit can withstand temperature up to 289 °C with minimum deformation. All prints were basically post-processed by washing in isopropyl alcohol and UV cured for 1 h under a 355 nm, 80 W cm⁻² source before any further post-processing as described in sections 2.2 and 2.3. The printing process was programmed in Autodesk PrintStudio.

To simulate the material behaviour of a low SVR 3D printed fluidic device and characterize its PCR performance in vitro, low-volume printed specimens were exposed to PCR mixture during amplification reactions that were performed conventionally. The specimens were post-processed at different extents to evaluate the efficiency of post-processing to reduce PCR inhibiting residuals. Prior to PCR sample preparation, nine cubes (1 mm³) were printed, washed in isopropanol, dried with air and post-cured in a UV oven (0.08 W cm⁻², 355 nm) for 1 h. Three cubes were placed in individual PCR tubes and sealed. The remaining six cubes were boiled and stirred in 100 ml deionized water. Three more cubes were placed in PCR tubes and sealed. The final three cubes were boiled in deionized water for 1 h and simultaneously exposed to UV light. They were then stored in PCR tubes and sealed. A PCR protocol to amplify a 1000 base pair long target was used for characterization. PCR mixture for nine reactions, three replicates for each post-processing condition, plus three controls was prepared. Each individual reaction contained 50% v/v FailSafe^® PCR buffer Premix D (Lucigen) with 4 mM MgCl₂ and 400 μM of each deoxyribonucleotide triphosphate (dNTP) (10 μM), 5% v/v of each primer (SeCopA P1 forward TGTCAATGAATTGATGACCAATCATAAAGGAGTTTT-TACTTGTAGGCTGGAGCTGCTTCG 10 µM and SeCopA P2 reverse CCGCCTTTAAGCAACTCGAATTATTTTGGGTATAGACTTTCATATGAATATCCTCCTTAG 10 µM), 1% v/v Taq DNA polymerase and 1% v/v plasmid DNA template solution (30 ng μl⁻¹) in molecular biology grade water. The reaction mixture was pipetted into the tubes, which were gently mixed, pulse spun and ran in a BioRad PCR thermocycler (figure 3(a)). The thermocycling protocol included an initial denaturation step at 95 °C for 5 min, followed by denaturation at 95 °C for 30 s, annealing at 52 °C for 30 s and extension at 68 °C for 60 s repeated for 35 cycles with a final extension step of 5 min. After thermocycling, the contents were resolved in a 1% (w/v) agarose gel for 35 min at 90 V, with a 10 µl of DNA ladder and imaged on a UV transilluminator.

To simulate a high SVR microfluidic architecture, a specimen of the same active 'wet' area (349 mm²) to the oscillating-flow PCR design (figure 1(a)) was designed to fit in a PCR polypropylene tube (figure 3(c)). The specimens were printed and fully post-processed to the last step detailed in section 2.2 with water washes and prolonged UV curing. Incubation of the specimens with PCR buffer–dNTPs–MgCl₂ mixture (FailSafe^® PCR, Premix D, Lucigen) and use of the mixture for subsequent PCR, allowed the extraction of conclusions regarding potential leachates from the printed polymer with PCR inhibiting behaviour, as well as adsorption of dNTPs and Mg ions. The direct incubation would restrict reagents mobility and introduce PCR inhibition irrelevant to material. Four specimens were added to individual PCR tubes. Fifty microlitres of buffer premix was added to each of the tubes, which were refrigerated for 23 h. Two tubes were further incubated at room temperature (RT) and the remaining two at 95 °C for 1 h. After incubation, 25 μl of each buffer was used to prepare two 50 μl reactions for each representative case, according to the PCR protocol described in section 2.2. The amplified samples were resolved on a 1% w/v agarose gel in Tris-acetate-Ethylenediaminetetraacetic acid (TAE) buffer at 90 V for 35 min. The gel was imaged on a BioRad transilluminator. It has to be mentioned that the experiment neglects PCR inhibition sources associated with fluid flow in flow-through PCR systems and is mostly representative for stationary PCR.

Zoom In Zoom Out Reset image size

2.4.1. Model chip design.

2.4.2. Chip fabrication.

A two-stage printing method with use of sacrificial wax was implemented (figure 2(a)). Initially, an open channel chip was regularly printed, positioned (in AM software) parallel to the projection plane without supports. To calibrate the printer before a print, the platform's ball screw is loosened and lowered towards the transparent window of the resin tray over the projection area, leaving a thin resin layer between them. The platform is then tightened in position and an open channel chip is printed. After printing, the platform was removed, and the open channels were cleaned with isopropanol and dried before applying sacrificial paraffin wax (melting point: 53 °C–57 °C (ASTM D 87), Sigma-Aldrich). The cleaning and wax deposition process occur with the printed part held on the platform. The second step of fabrication is a tedious manual operation and requires careful application of wax in the channel cavities and removal/cleaning from the face of the chip to avoid leakage issues. After careful cleaning and ensuring that wax has filled all channel cavities, the platform was placed back on the printer and was recalibrated, following the standard calibration procedure. A cap 3D model, virtually positioned at the same x–y coordinates with the previously printed chip, was then printed onto the existing chip, sealing the channels. The angular position of the platform was monitored from the first stage of printing and maintained for the second, so that inlets on the cap align with the channel ends. Given that no wax residuals are present in the face of the chip, the part sticks properly to each other as they are composed from the same photopolymer at its semi-polymerized state.

Zoom In Zoom Out Reset image size

Zoom In Zoom Out Reset image size

After a chip was printed, it was removed from the platform, washed in isopropanol and dried. It was then submerged in hot water, to melt the wax and flush it out using a syringe with hot water and isopropanol. The total time for fabrication of a non-post-processed part was 5 min for 0.8 mm (nominal) thick chips. The raw material cost per chip was calculated at approximately £0.25, considering 1.5 ml resin/chip and £170 l⁻¹ of resin. By using commercial microfluidic tubing and fittings, channels can be internally washed and treated by wet methods. For this work, eight chips were printed and fully post-processed as described in section 2.4.3.

2.4.3. Chips post-processing.

Three disks of 10 mm diameter and 1 mm thickness were printed in Formlabs Hi Temp resin and post-processed to the final step as described for the cube specimens in section 2.2. Siloxane pre-treatment: the disks were dipped individually and soaked in 20 ml of siloxane solution (Silester XAR) and left to dry in air for maximum 15 min before dipped into a solution of hydrolysed fluorosilane agent. Fluorosilane agent hydrolysis: the fluorosilane coupling agent (1H,1H,2H,2H-perfluorooctyltriethoxysilane, Sigma-Aldrich) was added to a 95:5 ethanol:deionised water solution yielding a 2% v/v concentration. Prior to the addition of the fluorinated agent, the pH of the ethanol–water solution was adjusted with glacial acetic acid at 4.5–5.5. The fluorosilane solution was stirred for 5–10 min to instigate silanol formation. Fluorosilane treatment: samples previously treated with siloxane and dried were dipped and stirred for 2 h in the hydrolysed fluorosilane solution. They were then dried with air and treated thermally at 110 °C for 10 min and stored in petri dishes prior to evaluation with contact angle visualizations and scanning electron microscopy (SEM) imaging. Characterization: water contact angle was measured on a F-theta tensiometer using 0.05 μl deionised water drops. SEM–energy dispersive x-ray spectroscopy (EDS) analysis was performed on a Hitachi TM3030.

Three disk specimens identical to those used for the fluorosilane modification were used for the PEG treatments. EDC/MES/NHS pre-treatment: three printed and post-processed disks were immersed in 20 ml of 6 M NaOH solution for 30 min. They were then rinsed with distilled water and dried with air. The disks were then pre-treated with an aqueous EDC hydrochloride (N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride)/MES hydrate (2-(N-morpholino) ethanesulfonic acid hydrate, 4-morpholineethanesulfonic acid)/NHS (N-hydroxysuccinimide) solution. NHS/EDC/MES solution was prepared by dissolving 0.5 M MES hydrate in stirring deionised water. EDC hydrochloride and NHS were added into the MES solution yielding a 10 mM concentration, respectively. The disks specimens were dipped into the stirring solution for approximately 5 h. They were then washed briefly with distilled water and dried with air before treated with PEG. PEG treatment: PEG dipping solution was prepared by adding methoxypolyethylene glycol amine powder (molecular weight: 5000, Alfa Aesar) into stirring deionised water yielding a 1% v/w concentration. Disks pre-treated with EDC/NHS/MES were dipped into the stirring PEG solution for approximately 5 h. The samples were then dried and stored in a petri dish prior to evaluation with SEM–EDS and water contact angle measurements as described in section 2.5.

A perfusion coating methodology was implemented to treat internally the microchannels. The fluorosilane and PEG coating and pre-coating solutions were prepared as described for the printed disk specimens. Fluorosilane perfusion treatment: a fully post-processed chip was filled with siloxane solution (Silester XAR) using a mechanical pipette, left for few minutes, and then thoroughly dried with pressurized air. The chip was then connected to the manifold and a single-channel syringe pump (PHD 4400 Harvard). Hydrolysed fluorosilane solution, prepared as described in section 2.5, flowed through the chip for approximately 2 h at low flow rates (0.1–1 ml min⁻¹). For the last hour, the chips were mounted onto—the Peltier module pairs for the PCR thermocycler at 110 °C. PEG perfusion treatment: the EDC/NHS/MES solution was prepared as described in section 2.6. Similarly, the chip was connected to the manifold and the syringe pump and the solution flowed through the chip at 0.1–1 ml min⁻¹ for approximately 5 h. After pre-treatment with EDC/NHS/MES complex, the chips were dried with air, connected to the manifold and syringe pump and treated similarly with the PEG solution for an additional 5 h.

For both types of functionalization, after the treatment was completed, they were disconnected from the manifold and thoroughly washed with PCR-grade water and dried with pressurized air. Particularly for the fluorosilane treatment, thorough cleaning is highly important due to the high toxicity and PCR inhibiting behaviour of residual siloxanes and hydrolysed fluorosilanes.

The critical dimensions and surface quality of the printed channels were evaluated by optical stereo and focus variation microscopy. Ten width and height measurements were conducted along the channel pattern for each of six chip replicates, retrieved from functional tests. Surface quality was evaluated by measuring average surface roughness on vertically and horizontally printed channel walls. For each of the cases, ten measurements were performed for six chip replicates along a 3 mm track on the printed channels. The top-channel wall formed during cap printing, possess surface roughness equal and inverse to the wax layer surface roughness. As wax deposition was performed manually, the roughness is not a process-associated variable and was not characterized in this work. To perform the measurements, chips were cross sectioned with a diamond coated disk cutter.

To differentiate between inhibition due to surface interactions and chemical leaching, a qPCR testing methodology was used. PCR-grade water was thermally cycled according to a two-step PCR protocol in the 3D printed chip as described in section 2.10. In this way leachates from the chips were accumulated in water samples, subsequently used to prepare corresponding qPCR reactions. The real-time amplification data were compared to control reactions prepared with fresh water. Each qPCR reaction volume contained 20% v/v Phire buffer (5×), 200 μM dNTPs (10 mM), 0.5 μM v/v forward and reverse primer (SN086 forward TATGGGAAAGGTTCTGAA 10 μM, SN087 reverse TACAGATTGACTTCGATG 10 μM) respectively, 4% v/v human genomic DNA template (2000 copies μl⁻¹), 5% v/v EvaGreen stain (20×, diluted with water to 1× final concentration) and 2% v/v Phire II hot start polymerase in the respective leachate water or fresh water for the controls. The reactions ran on a BioRad qPCR thermocycler, according to thermocycling protocol including an initial denaturation step at 95 °C for 300 s, following by denaturation at 95 °C for 10 s annealing at 50 °C for 10 s and extension at 72 °C repeated for 50 cycles.

The oscillating-flow PCR thermocycler consisted of a two-channel syringe pump and a set of two Peltier elements for controlling chip fluid positioning and temperature, respectively (figure 1(c)). Fluid positioning and temperature was controlled through a National Instruments DAQ board and individual temperature controllers (CAL 3200, RS UK) in a Visual Studio application.

To simulate a two-step PCR protocol, a chip was loaded with 50 μl fluid sample (20% v/v glycerol in purified water) using a mechanical pipette and positioned in the denaturation zone. The chip was connected to the two-channel syringe pump through the manifold and 25 cm long 1/16 polypropylene tubing from both ends (figure 1(c)). One millilitre plastic syringes were used. The chip was then placed between the Peltier elements, so that each serpentine channel region is positioned within the active area of the heater. The chips were pressurized from both ends by positive syringe displacements to ensure that there are no leakages and the fluid stream hold its positioning without shuttering or drifting. The fluid was then pushed or pulled between each temperature region in the channel, by equal displacements of opposite direction for each syringe pump to perform two-step thermocycling. A full two-step PCR protocol ran with 80:20 water:glycerol with no leakages observed at the functional temperatures. The protocol included an initial denaturation step at 99 °C for 60 s, followed by denaturation at 99 °C for 5 s and extension annealing at 68 °C for 10 s repeated for 35 cycles. The total thermocycling time was 9.75 min. No deformations or material deterioration was observed for any of the printed chip replicates during or after thermocycling.

To perform leach testing on a 3D printed chip, 50 μl PCR-grade water samples were thermally cycled according to a two-step PCR protocol for genomic template reactions as described in section 2.10. The water eluents were then collected and used to prepare representative qPCR reactions and record inhibition events. The values were compared to a positive control reaction ran conventionally. Four fully post-processed and non-treated, two fluorosilane-modified and two PEG-modified chip replicates were tested. The simulated oscillating-flow thermocycling protocol included an initial denaturation step at 99 °C for 60 s, followed by denaturation at 99 °C for 5 s and extension annealing at 68 °C for 10 s repeated for 35 cycles. The total thermocycling time was 9.75 min. After thermocycling, the chips were depressurized, and the water leachates were retrieved and stored. Three consecutive water samples of 50 μl were thermally cycled for each of the chips tested. The water eluents were then used to prepare PCR mixture for totally twelve 25 μl qPCR reactions as described in section 2.9.

The width of the channels shows consistent negative deviation of −15% compared to the nominal value (0.4 mm) across six chip replicates. The printing accuracy is in agreement with common accuracy performance of DLP printers. Shrinkage of micro-features can also be attributed over-exposure of printed layers at the order of milliseconds. Lower levels of dimensional deviation were observed for channel height and cross-sectional area, approximately +5% and −5% respectively (figure 2(b)). The average surface roughness of a printed channel was 0.517 ± 0.221 μm at the bottom wall and 1.108 ± 0.149 μm on the side wall (figures 2(c)–(e)). This result displays the characteristic linear increase of surface roughness with print orientation angle in SLA prints.

Reactions performed in the presence of low volumes of printed material, indicated that basic post-processing with only isopropanol washes and UV light (figure 3(b): bands 1–3) did not efficiently reduce PCR inhibiting residuals, judging from the fact that only a faint PCR product is visible. The reactions performed with printed specimens, previously post-processed with hot water and further UV curing (figure 3(b): bands 4–8) yield amplicon concentrations comparable to the positive control (figure 3(b): band 10), indicating the significant reduction of PCR inhibiting residuals after prolonged water washes of the prints. Negative control reactions lacking template DNA (figure 3(b): band 11) and enzyme (figure 3(b): band 12) respectively, did not generate any product. It must be mentioned that band no 4 (figure 3(b): band 4) shows faint amplicon concentration even though the reaction represents post-processing groups II and III that repeatably produced amplicons consistent with the controls. This is attributed to pipetting errors during loading of the gel that resulted in loss of amplicon. Higher SVR specimens were incubated with buffer–dNTPs–MgCl₂ mixture at 25 °C and 95 °C. The reactions prepared with the incubated mixture produced agarose gel bands similar to the positive control (figure 3(d): band 5), that was prepared with fresh buffer mixture (figure 3(d): bands 2–4). This result indicates that no leachates from the prints exhibit a strong PCR inhibiting behaviour, while compounds such as dNTPs and Mg ions premixed into the PCR buffer are not absorbed. Negative control reactions lacking template DNA (figure 3(d): band 6) and enzyme (figure 3(d): band 7) respectively did not generate any product.

SEM–EDS analysis of the non-treated printed surface indicated the organic composition of the printed resin with the elemental signatures of carbon and oxygen only recorded (figures 4(a) and (b)). PEG-modified surface in EDS analysis indicated an increased oxygen content that reflects the oxygen-rich PEG and EDC/NHS/MES complex (figure 4(e)), but not obvious alterations were observed in the functionalized surface structure (figure 4(d)). Fluorosilane-modified specimens showed explicit alterations on the surface (figure 4(g)) with distinctive elemental signals obtained for silicon and fluorine (figure 4(h)), the main components of the silane agent. Non-treated samples displayed a slight hydrophobic behaviour with average water contact angle values of 80° (figure 4(c)). Fluorosilane-modified samples demonstrate values of approximately 115°, indicative of the fluorinated hydrophobic terminal portions of the silane agent (figure 4(c)). PEG-coated samples demonstrate a hydrophilic surface with water contact angle values of approximately 38° (figure 4(f)).

Zoom In Zoom Out Reset image size

A representative amplification curve and the relative cycle efficiency, enzyme activity and Ct lag data for the first tested chip and three consecutive water leachates are presented in figures 5(a)–(d). Cycle efficiency values that exceed 100% indicate reduced enzyme activity owed to the presence of inhibitors in the water eluents. This imposes the requirement of more cycles to reach the threshold of detection compared to the control. This delay is recorded as cycle threshold lag. Interactions of ambient inhibitors with enzyme, apart from limiting its availability, can also result in non-specific target generation, as the enzyme fails to fully extend a target sequence in a given time period resulting in generation of shorter, non-specific sequences. For the reactions prepared with the second and third leachate water eluent for the same chip all values are improved and become more consistent with the control reaction. This indicates that washing of residuals is still ongoing, while water is thermally cycled into chips. An extended water wash period can be implemented for 3D printed chips based on this result, simultaneously studying changes in the material water uptake.

Zoom In Zoom Out Reset image size

The qPCR analysis results for leachates from all non-functionalized, fluorosilane- and PEG-modified chips are summarized in figures 5(e)–(g). The modified cartridges, irrelevant to the modification method display improved overall PCR efficiency owed to the presence of lower inhibiting leachate content compared to non-functionalized cartridges. The relative early cycle efficiency values were kept close to, but not higher than 100%, similar to the values of the positive control, while enzyme efficiency and Ct lag values were improved compared to those of non-functionalized chips. Apart from reducing the leaching interface, functionalization shows promise for limiting adsorption during on-chip PCR.