A De Novo Transcriptomics Approach Reveals Genes Involved in Thrips Tabaci Resistance to Spinosad
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insects Rearing and Resistance Bioassay
2.2. RNA Extraction and Sample Preparation for Sequencing
2.3. cDNA Library Construction and Illumina Sequencing
2.4. De Novo Transcriptome Assembly and Functional Annotation
2.5. Reverse Transcription-PCR and Quantitative Real Time PCR (qRT-PCR)
2.6. Fecundity Experiments
3. Results
3.1. Transcriptome Sequencing, Assembly and Annotation
3.2. DEGs and Resistance Related Genes
3.3. Verifying Expression Levels of Candidate Gene Using qRT-PCR
3.4. Fecundity of Resistant and Susceptible Populations to Spinosad
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Diaz-Montano, J.; Fuchs, M.; Nault, B.A.; Fail, J.; Shelton, A.M. Onion thrips (Thysanoptera: Thripidae): A global pest of increasing concern in onion. J. Econ. Èntomol. 2011, 104, 1–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lebedev, G.; Abo-Moch, F.; Gafni, G.; Ben-Yakir, D.; Ghanim, M. High-level of resistance to spinosad, emamectin benzoate and carbosulfan in populations of Thrips tabaci collected in Israel. Pest Manag. Sci. 2012, 69, 274–277. [Google Scholar] [CrossRef] [PubMed]
- Cranshaw, W. Control of organophosphate-resistant onion thrips. Insectic Acaric. Tests 1989, 14, 128. [Google Scholar]
- Herron, G.A.; Langfield, B.J.; Tomlinson, T.M.; Mo, J. Dose-response testing of Australian populations of onion thrips Thrips tabaci Lindeman (Thysanoptera: Thripidae) further refines baseline data and detects methidathion and likely imidacloprid resistance. Aust. J. Èntomol. 2011, 50, 418–423. [Google Scholar] [CrossRef]
- MacIntyre Allen, J.K.; Scott-Dupree, C.D.; Tolman, J.H.; Ron Harris, C. Resistance of Thrips tabaci to pyrethroid and organophosphorus insecticides in Ontario, Canada. Pest Manag. Sci. 2005, 61, 809–815. [Google Scholar] [CrossRef]
- Martin, N.; Workman, P.; Butler, R. Insecticide resistance in onion thrips (Thrips tabaci) (Thysanoptera: Thripidae). New Zeal. J. Crop Hort. Sci. 2003, 31, 99–106. [Google Scholar] [CrossRef] [Green Version]
- Morishita, M.P. Pyrethroid-resistant onion thrips, Thrips tabaci Lindeman (Thysanoptera: Thripidae), infesting persimmon fruit. Appl. Èntomol. Zoöl. 2008, 43, 25–31. [Google Scholar] [CrossRef] [Green Version]
- Richardson, B.; Wene, G. Control of onion thrips and its tolerance to certain chlorinated hydrocarbons. J. Econ. Èntomol. 1956, 49, 333–335. [Google Scholar] [CrossRef]
- Shelton, A.; Nault, B.; Plate, J.; Zhao, J. Regional and temporal variation in susceptibility to λ-cyhalothrin in onion thrips, Thrips tabaci (Thysanoptera: Thripidae), in onion fields in New York. J. Econ. Èntomol. 2003, 96, 1843–1848. [Google Scholar] [CrossRef]
- Mertz, F.P.; Yao, R.C. Saccharopolyspora spinosa sp. nov. isolated from soil collected in a sugar mill rum still. Int. J. Syst. Bacteriol 1990, 40, 34–39. [Google Scholar] [CrossRef]
- Sparks, T.C.; Thompson, G.D.; Kirst, H.A.; Hertlein, M.B.; Larson, L.L.; Worden, T.V.; Thibault, S.T. Biological Activity of the Spinosyns, New Fermentation Derived Insect Control Agents, on Tobacco Budworm (Lepidoptera: Noctuidae) Larvae. J. Econ. Èntomol. 1998, 91, 1277–1283. [Google Scholar] [CrossRef]
- Thompson, G.D.; Dutton, R.; Sparks, T.C. Spinosad—A case study: An example from a natural products discovery programme. Pest Manag. Sci. 2000, 56, 696–702. [Google Scholar] [CrossRef]
- Salgado, V.L. Studies on the Mode of Action of Spinosad: Insect Symptoms and Physiological Correlates. Pestic. Biochem. Physiol. 1998, 60, 91–102. [Google Scholar] [CrossRef]
- Orr, N.; Shaffner, A.J.; Richey, K.; Crouse, G.D. Novel mode of action of spinosad: Receptor binding studies demonstrating lack of interaction with known insecticidal target sites. Pestic. Biochem. Physiol. 2009, 95, 1–5. [Google Scholar] [CrossRef]
- Salgado, V.L.; Saar, R. Desensitizing and non-desensitizing subtypes of alpha-bungarotoxin-sensitive nicotinic acetylcholine receptors in cockroach neurons. J. Insect. Physiol. 2004, 50, 867–879. [Google Scholar] [CrossRef]
- Watson, G.B.; Chouinard, S.W.; Cook, K.R.; Geng, C.; Gifford, J.M.; Gustafson, G.D.; Hasler, J.M.; Larrinua, I.M.; Letherer, T.J.; Mitchell, J.C. A spinosyn-sensitive Drosophila melanogaster nicotinic acetylcholine receptor identified through chemically induced target site resistance, resistance gene identification, and heterologous expression. Insect Biochem. Mol. Biol. 2010, 40, 376–384. [Google Scholar] [CrossRef]
- Watson, G.B. Actions of Insecticidal Spinosyns on γ-Aminobutyric Acid Responses from Small-Diameter Cockroach Neurons. Pestic. Biochem. Physiol. 2001, 71, 20–28. [Google Scholar] [CrossRef]
- Ferguson, J.S. Development and stability of insecticide resistance in the leafminer Liriomyza trifolii (Diptera: Agromyzidae) to cyromazine, abamectin, and spinosad. J. Econ. Èntomol. 2004, 97, 112–119. [Google Scholar] [CrossRef] [Green Version]
- Hsu, J.C.; Feng, H.T. Development of resistance to spinosad in oriental fruit fly (Diptera: Tephritidae) in laboratory selection and cross-resistance. J. Econ. Èntomol. 2006, 99, 931–936. [Google Scholar] [CrossRef]
- Ishtiaq, M.; Saleem, M.A. Generating susceptible strain and resistance status of field populations of Spodoptera exigua (Lepidoptera: Noctuidae) against some conventional and new chemistry insecticides in Pakistan. J. Econ. Èntomol. 2011, 104, 1343–1348. [Google Scholar] [CrossRef]
- Shono, T.; Scott, J.G. Spinosad resistance in the housefly, Musca domestica, is due to a recessive factor on autosome 1. Pestic. Biochem. Phys. 2003, 75, 1–7. [Google Scholar] [CrossRef]
- Sparks, T.C.; Dripps, J.E.; Watson, G.B.; Paroonagian, D. Resistance and cross-resistance to the spinosyns—A review and analysis. Pestic. Biochem. Physiol. 2012, 102, 1–10. [Google Scholar] [CrossRef]
- Zhao, J.; Collins, H.; Li, Y.; Mau, R.F.L.; Thompson, G.; Hertlein, M.; Andaloro, J.T.; Boykin, R.; Shelton, A.M. Monitoring of diamondback moth (Lepidoptera: Plutellidae) resistance to spinosad, indoxacarb, and emamectin benzoate. J. Econ. Èntomol. 2006, 99, 176–181. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.-Z.; Li, Y.-X.; Collins, H.L.; Gusukuma-Minuto, L.; Mau, R.F.L.; Thompson, G.D.; Shelton, A.M. Monitoring and Characterization of Diamondback Moth (Lepidoptera: Plutellidae) Resistance to Spinosad. J. Econ. Èntomol. 2002, 95, 430–436. [Google Scholar] [CrossRef] [Green Version]
- Bielza, P.; Quinto, V.; Contreras, J.; Torné, M.; Martín, A.; Espinosa, P.J. Resistance to spinosad in the western flower thrips, Frankliniella occidentalis (Pergande), in greenhouses of south-eastern Spain. Pest Manag. Sci. 2007, 63, 682–687. [Google Scholar] [CrossRef]
- Herron, G.A.; James, T.M.; Rophail, J.; Mo, J. Australian populations of onion thrips, Thrips tabaci Lindeman (Thysanoptera: Thripidae), are resistant to some insecticides used for their control. Aust. J. Èntomol. 2008, 47, 361–364. [Google Scholar] [CrossRef]
- Puinean, A.M.; Lansdell, S.J.; Collins, T.; Bielza, P.; Millar, N.S. A nicotinic acetylcholine receptor transmembrane point mutation (G275E) associated with resistance to spinosad in Frankliniella occidentalis. J. Neurochem. 2013, 124, 590–601. [Google Scholar] [CrossRef] [Green Version]
- Chen, E.-H.; Wei, D.-D.; Shen, G.-M.; Yuan, G.-R.; Bai, P.-P.; Wang, J. De novo characterization of the Dialeurodes citri transcriptome: Mining genes involved in stress resistance and simple sequence repeats (SSRs) discovery. Insect Mol. Biol. 2013, 23, 52–66. [Google Scholar] [CrossRef]
- Niu, J.-Z.; Dou, W.; Ding, T.-B.; Shen, G.-M.; Zhang, K.; Smagghe, G.; Wang, J. Transcriptome analysis of the citrus red mite, Panonychus citri, and its gene expression by exposure to insecticide/acaricide. Insect Mol. Biol. 2012, 21, 422–436. [Google Scholar] [CrossRef]
- Shen, G.-M.; Dou, W.; Niu, J.-Z.; Jiang, H.-B.; Yang, W.-J.; Jia, F.-X.; Hu, F.; Cong, L.; Wang, J. Transcriptome Analysis of the Oriental Fruit Fly (Bactrocera dorsalis). PLoS ONE 2011, 6, e29127. [Google Scholar] [CrossRef]
- Xie, W.; Meng, Q.S.; Wu, Q.J.; Wang, S.L.; Yang, X.; Yang, N.N.; Li, R.M.; Jiao, X.G.; Pan, H.P.; Liu, B.M.; et al. Pyrosequencing the Bemisia tabaci transcriptome reveals a highly diverse bacterial community and a robust system for insecticide resistance. PLoS ONE 2012, 7, e35181. [Google Scholar] [CrossRef] [PubMed]
- Yang, N.; Xie, W.; Jones, C.; Bass, C.; Jiao, X.; Yang, X. Transcriptome profiling of the whitefly Bemisia tabaci reveals stage-specific gene expression signatures for thiamethoxam resistance. Insect Mol. Biol. 2013, 22, 485–496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Z.; Zhang, P.; Li, W.; Zhang, J.; Huang, F.; Yang, J.; Bei, Y.; Lu, Y.-B. De novo transcriptome sequencing in Frankliniella occidentalis to identify genes involved in plant virus transmission and insecticide resistance. Genomics 2013, 101, 296–305. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kontsedalov, S.; Weintraub, P.G.; Horowitz, A.R.; Ishaaya, I. Effects of Insecticides on Immature and Adult Western Flower Thrips (Thysanoptera: Thripidae) in Israel. J. Econ. Èntomol. 1998, 91, 1067–1071. [Google Scholar] [CrossRef]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef] [Green Version]
- Iseli, C.; Jongeneel, C.V.; Bucher, P. ESTScan: A program for detecting, evaluating, and reconstructing potential coding regions in EST sequences. In Proceedings of the International Conference on Intelligent Systems for Molecular Biology, Heidelberg, Germany, 1 January 1999. [Google Scholar]
- Conesa, A.; Götz, S.; García-Gómez, J.M.; Terol, J.; Talón, M.; Robles, M. Blast2GO: A universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 2005, 21, 3674–3676. [Google Scholar] [CrossRef] [Green Version]
- Ye, J.; Fang, L.; Zheng, H.; Zhang, Y.; Chen, J.; Zhang, Z.; Wang, J.M.; Li, S.; Li, R.; Bolund, L. WEGO: A web tool for plotting GO annotations. Nucleic Acids Res. 2006, 34, W293–W297. [Google Scholar] [CrossRef]
- Li, X.; Schuler, M.A.; Berenbaum, M.R. Molecular Mechanisms of Metabolic Resistance to Synthetic and Natural Xenobiotics. Annu. Rev. Èntomol. 2007, 52, 231–253. [Google Scholar] [CrossRef]
- Bloomquist, J.R. Ion channels as targets for insecticides. Annu. Rev. Èntomol. 1996, 4, 163–190. [Google Scholar] [CrossRef]
- Scott, J.G. Cytochromes P450 and insecticide resistance. Insect Biochem. Mol. Biol. 1999, 29, 757–777. [Google Scholar] [CrossRef]
- Tufail, M.; Takeda, M. Insect vitellogenin/lipophorin receptors: Molecular structures, role in oogenesis, and regulatory mechanisms. J. Insect Physiol. 2009, 55, 88–104. [Google Scholar] [CrossRef] [PubMed]
- Kliot, A.; Ghanim, M. Fitness costs associated with insecticide resistance. Pest Manag. Sci. 2012, 68, 1431–1437. [Google Scholar] [CrossRef] [PubMed]
- Arthoropod Pesticide Resistance Database. Available online: http://www.pesticideresistance.org/ (accessed on 5 July 2012).
- Hou, R.; Bao, Z.; Wang, S.; Su, H.; Li, Y.; Du, H.; Hu, J.; Wang, S.; Hu, X. Transcriptome Sequencing and De Novo Analysis for Yesso Scallop (Patinopecten yessoensis) Using 454 GS FLX. PLoS ONE 2011, 6, e21560. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Novaes, E.; Drost, D.R.; Farmerie, W.G.; Pappas, G.J.; Grattapaglia, D.; Sederoff, R.R.; Kirst, M. High-throughput gene and SNP discovery in Eucalyptus grandis, an uncharacterized genome. BMC Genom. 2008, 9, 312. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sims, D.W.; Sudbery, I.M.; Ilott, N.E.; Heger, A.; Ponting, C.P. Sequencing depth and coverage: Key considerations in genomic analyses. Nat. Rev. Genet. 2014, 15, 121–132. [Google Scholar] [CrossRef]
- Perry, T.; McKenzie, J.A.; Batterham, P. A Dα6Dα6 knockout strain of Drosophila melanogaster confers a high level of resistance to spinosad. Insect Biochem. Mol. Biol. 2007, 37, 184–188. [Google Scholar] [CrossRef]
- Rinkevich, F.D.; Chen, M.; Shelton, A.M.; Scott, J.G. Transcripts of the nicotinic acetylcholine receptor subunit gene Pxylα6 with premature stop codons are associated with spinosad resistance in diamondback moth, Plutella xylostella. Invertebr. Neurosci. 2010, 10, 25–33. [Google Scholar] [CrossRef]
- Audic, S.; Claverie, J.-M. The significance of digital gene expression profiles. Genome Res. 1997, 7, 986–995. [Google Scholar] [CrossRef]
- Scott, J.G. Investigating Mechanisms of Insecticide Resistance: Methods, Strategies, and Pitfalls; Springer: Boston, MA, USA; pp. 39–57. [CrossRef]
- Bergé, J.B.; Feyereisen, R.; Amichot, M. Cytochrome P450 monooxygenases and insecticide resistance in insects. Philos. Trans. R. Soc. B Biol. Sci. 1998, 353, 1701–1705. [Google Scholar] [CrossRef] [Green Version]
- Awan, D.A.; Saleem, M.A.; Nadeem, M.S.; Shakoori, A. Toxicological and Biochemical Studies on Spinosad and Synergism with Piperonyl Butoxide in Susceptible and Resistant Strains of Tribolium castaneum. Pak. J. Zool. 2012, 44, 649–662. [Google Scholar]
- Wang, W.; Mo, J.; Cheng, J.; Zhuang, P.; Tang, Z. Selection and characterization of spinosad resistance in Spodoptera exigua (Hübner) (Lepidoptera: Noctuidae). Pestic. Biochem. Physiol. 2006, 84, 180–187. [Google Scholar] [CrossRef]
- Wang, N.; Qiu, X.; Ren, X.; Niu, F.; Wang, K. Resistance selection and biochemical characterization of spinosad resistance in Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). Pestic. Biochem. Physiol. 2009, 95, 90–94. [Google Scholar] [CrossRef]
- Ahmad, M.; Denholm, I.; Bromilow, R.H. Delayed cuticular penetration and enhanced metabolism of deltamethrin in pyrethroid-resistant strains ofHelicoverpa armigera from China and Pakistan. Pest Manag. Sci. 2006, 62, 805–810. [Google Scholar] [CrossRef]
- Jensen, S.E. Insecticide Resistance in the Western Flower Thrips, Frankliniella occidentalis. Integr. Pest Manag. Rev. 2000, 5, 131–146. [Google Scholar] [CrossRef]
- Pimprikar, G.D.; Georghiou, G.P. Mechanisms of resistance to diflubenzuron in the house fly, Musca domestica (L.). Pestic. Biochem. Phys. 1979, 12, 10–22. [Google Scholar] [CrossRef]
- Pedrini, N.; Mijailovsky, S.J.; Girotti, J.R.; Stariolo, R.; Cardozo, R.M.; Gentile, A.; Juárez, M.P. Control of pyrethroid-resistant Chagas disease vectors with entomopathogenic fungi. PLoS Negl. Trop. Dis. 2009, 3, e434. [Google Scholar] [CrossRef] [Green Version]
- Wood, O.R.; Hanrahan, S.; Coetzee, M.; Koekemoer, L.L.; Brooke, B.D. Cuticle thickening associated with pyrethroid resistance in the major malaria vector Anopheles funestus. Parasites Vectors 2010, 3, 67. [Google Scholar] [CrossRef] [Green Version]
- Forshaw, P.; Lister, T.; Ray, D.E. The Role of Voltage-Gated Chloride Channels in Type II Pyrethroid Insecticide Poisoning. Toxicol. Appl. Pharmacol. 2000, 163, 1–8. [Google Scholar] [CrossRef]
- Ray, D.E.; Sutharsan, S.; Forshaw, P.J. Actions of pyrethroid insecticides on voltage-gated chloride channels in neuroblastoma cells. NeuroToxicology 1997, 18, 755–760. [Google Scholar]
- Soderlund, D.M.; Clark, J.M.; Sheets, L.P.; Mullin, L.S.; Piccirillo, V.J.; Sargent, D.; Stevens, J.T.; Weiner, M.L. Mechanisms of pyrethroid neurotoxicity: Implications for cumulative risk assessment. Toxicology 2002, 171, 3–59. [Google Scholar] [CrossRef]
- Liu, J.; Shi, G.-P.; Zhang, W.-Q.; Zhang, G.-R.; Xu, W.-H. Cathepsin L function in insect moulting: Molecular cloning and functional analysis in cotton bollworm, Helicoverpa armigera. Insect Mol. Biol. 2006, 15, 823–834. [Google Scholar] [CrossRef] [PubMed]
- Koo, Y.D.; Ahn, J.-E.; Salzman, R.A.; Moon, J.; Chi, Y.H.; Yun, D.-J.; Lee, S.Y.; Koiwa, H.; Zhu-Salzman, K. Functional expression of an insect cathepsin B-like counter-defence protein. Insect Mol. Biol. 2008, 17, 235–245. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Lu, Y.-X.; Liu, J.; Yang, C.; Feng, Q.-L.; Xu, W.-H. A Regulatory Pathway, Ecdysone-Transcription Factor Relish-Cathepsin L, Is Involved in Insect Fat Body Dissociation. PLoS Genet. 2013, 9, e1003273. [Google Scholar] [CrossRef]
- Goptar, I.; Semashko, T.; Danilenko, S.; Lysogorskaya, E.; Oksenoit, E.; Zhuzhikov, D.; Belozersky, M.; Dunaevsky, Y.; Oppert, B.; Filippova, I.; et al. Cysteine digestive peptidases function as post-glutamine cleaving enzymes in tenebrionid stored-product pests. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2012, 161, 148–154. [Google Scholar] [CrossRef]
- Cho, W.-L.; Tsao, S.-M.; Hays, A.R.; Walter, R.; Chen, J.-S.; Snigirevskaya, E.S.; Raikhel, A.S. Mosquito Cathepsin B-like Protease Involved in Embryonic Degradation of Vitellin Is Produced as a Latent Extraovarian Precursor. J. Biol. Chem. 1999, 274, 13311–13321. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; McCarron, R.C.; Nordin, J.H. A Cysteine Protease That Processes Insect Vitellin purification and partial characterization of the enzyme and the proenzyme. J. Biol. Chem. 1996, 271, 33344–33351. [Google Scholar] [CrossRef] [Green Version]
- Oliveira, D.M.; Ramos, I.B.; Reis, F.C.; Lima, A.P.; Machado, E.A. Interplay between acid phosphatase and cysteine proteases in mediating vitellin degradation during early embryogenesis of Periplaneta americana. J. Insect Physiol. 2008, 54, 883–891. [Google Scholar] [CrossRef]
- Shiba, H.; Uchida, D.; Kobayashi, H.; Natori, M. Involvement of Cathepsin B- and L-Like Proteinases in Silk Gland Histolysis during Metamorphosis of Bombyx mori. Arch. Biochem. Biophys. 2001, 390, 28–34. [Google Scholar] [CrossRef]
- Yamahama, Y.; Uto, N.; Tamotsu, S.; Miyata, T.; Yamamoto, Y.; Watabe, S.; Takahashi, S. In vivo activation of pro-form Bombyx cysteine protease (BCP) in silkmoth eggs: Localization of yolk proteins and BCP, and acidification of yolk granules. J. Insect Physiol. 2003, 49, 131–140. [Google Scholar] [CrossRef]
- Yamamoto, Y.; Takahashi, S.Y. Cysteine proteinase from Bombyx eggs: Role in programmed degradation of yolk proteins during embryogenesis. Comp. Biochem. Physiol. Part B Comp. Biochem. 1993, 106, 35–45. [Google Scholar] [CrossRef]
- Raikhel, A.S.; Dhadialla, T. Accumulation of yolk proteins in insect oocytes. Annu. Rev. Èntomol. 1992, 37, 217–251. [Google Scholar] [CrossRef] [PubMed]
- Bielza, P.; Quinto, V.; Grávalos, C.; Abellán, J. Fernández, E. Lack of fitness costs of insecticide resistance in the western flower thrips (Thysanoptera: Thripidae). J. Econ. Èntomol. 2008, 101, 499–503. [Google Scholar] [CrossRef]
- Williams, I.S.; Haylock, L.A.; MDewar, A.; Dixon, A.F.G. Selection for a moderately insecticide resistant clone of Myzus persicae (Hemiptera: Aphididae) on sugarbeet in the absence of pesticides. Bull. Èntomol. Res. 1998, 88, 653–658. [Google Scholar] [CrossRef]
Name of Primers | Target Gene | Sequence (5′ > 3′) | Product Size (bp) | Tm |
---|---|---|---|---|
CL585C5-F | Tubulin (CL585) | TTCCACTGCTGTTGTTGAGC | 98 | 58 |
CL585C5-R | AGATGGCCTCATTGTCAACC | |||
CL844- F | CYP450 (CL844) | CTGGGACTTGTTGTGGACCT | 175 | 58 |
CL844-R | GGACTTTTCGGTGTGCTTGT | |||
CL1604C5-F | Vitellogenin (CL1604) | TTTTTGATTGTGACCGACCA | 62 | 58 |
CL1604C5-R | CAAAAGTCCAGCACCCAGTT |
Population Name | LC50 (Range) ppm a | Slope a | RR50 b |
---|---|---|---|
S | 0.6 (0.5–0.7) | 1.6 ± 0.2 | 1.0 |
MR (selected) | 117.2 (92.2–167.6) | 0.1 ± 0.0 | 212.7 |
HR | 23258.0 (15660.1–55825.2) | 0.001 | 42,210.6 |
Sample | Sus1 | Sus2 | Res1 | Res2 |
---|---|---|---|---|
Total clean Reads | 26,761,394 | 26,187,172 | 27,162,192 | 26,163,866 |
Unigenes number | 47,927 | 44,380 | 48,605 | 47,150 |
Unigenes mean length | 581 | 581 | 575 | 609 |
Gene ID | Potential Function | Expression Ratio a | FDR b |
---|---|---|---|
Unigene22894 | Cytochrome P450 | 5.67 | FDR ≤ 2.310−24 |
CL844 | Cytochrome P450 | 5.07 | FDR ≤ 2.40 × 10−26 |
Unigene20207 | Cytochrome P450 | 3.25 | FDR ≤ 2.26 × 10−14 |
CL490 | voltage gated chloride channel | 11.88 | FDR ≤ 2.29 × 10−38 |
Unigene9317 | voltage gated chloride channel | 11.17 | FDR ≤ 5.97 × 10−75 |
CL353 | cuticle protein | 8.35 | FDR ≤ 1.38 × 10−30 |
CL2493 | cuticle protein | 9.8 | FDR ≤ 5.58 × 10−164 |
CL2817 | cysteine protease | 0.0025 | FDR ≤ 2.66 × 10−100 |
CL1604 | Vitellogenin-5 | 17.06 | FDR ≤ 15.15 × 10−5 |
Gene ID | Annotated Gene | database | Accession Number | E Value | Gene Ontology (GO) |
---|---|---|---|---|---|
Unigene 22894 | cytochrome P450 4g15-like (Bombus terrestris) | Nr | XP_003399611.1 | 2 × 10−109 | GO:0044464, cell part |
CL844 | cytochrome P450 (Bemisia tabaci) | Nr | AEK21806.1 | 1 × 10−126 | GO:0046872,metal ion binding/GO:0016491, oxidoreductase activity/GO:0016020, membrane |
Unigene 20207 | cytochrome P450 enzyme, CYP4C39 enzyme (Carcinus maenas) | Nr | JC8026 | 5 × 10−56 | GO:0044464, cell part |
CL490 | voltage gated chloride channel domain-containing protein (Toxoplasma gondii) | Nr | XP_002368679.1 | 2 × 10−6 | − |
Unigene 9317 | voltage gated chloride channel domain-containing protein (Toxoplasma gondii) | Nr | XP_002368679.1 | 9 × 10−6 | − |
CL353 | cuticle protein (Nasonia vitripennis) | Nr | XP_001606311.1 | 7 × 10−12 | − |
CL2493 | cuticle protein 16.5 Isoform A (Locusta migratoria) | Swiss-prot | P83992 | 3 × 10−20 | GO:0042302, Molecular Function |
CL2817 | cysteine protease CP19 precursor (Frankliniella occidentalis) | Nr | AAL02223.1 | 6 × 10−67 | GO:0016787, hydrolase activity |
CL1604 | Vitellogenin-5 (Camponotus floridanus) | Nr | ADZ13687.1 | 2 × 10−8 | − |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rosen, R.; Lebedev, G.; Kontsedalov, S.; Ben-Yakir, D.; Ghanim, M. A De Novo Transcriptomics Approach Reveals Genes Involved in Thrips Tabaci Resistance to Spinosad. Insects 2021, 12, 67. https://doi.org/10.3390/insects12010067
Rosen R, Lebedev G, Kontsedalov S, Ben-Yakir D, Ghanim M. A De Novo Transcriptomics Approach Reveals Genes Involved in Thrips Tabaci Resistance to Spinosad. Insects. 2021; 12(1):67. https://doi.org/10.3390/insects12010067
Chicago/Turabian StyleRosen, Ran, Galina Lebedev, Svetlana Kontsedalov, David Ben-Yakir, and Murad Ghanim. 2021. "A De Novo Transcriptomics Approach Reveals Genes Involved in Thrips Tabaci Resistance to Spinosad" Insects 12, no. 1: 67. https://doi.org/10.3390/insects12010067