A G-quadruplex nanoswitch in the SGK1 promoter regulates isoform expression by K+/Na+ balance and resveratrol binding
Graphical abstract
Introduction
Potassium/sodium balance helps maintain vital body functions. High sodium intake is responsible for salt-sensitive hypertension. While the effectiveness of the current dietary sodium guidelines in reducing the risk of cardiovascular morbidity and mortality is in question [1], increasing potassium intake or adopting a vegetarian diet is believed to be beneficial in helping to control elevated blood pressure and risk of stroke [2,3]. Possible mechanisms for the antihypertensive effects of potassium or resveratrol, a natural polyphenolic molecule found in fruits and vegetables, are suggested to involve alterations in the activity of the rennin-angiotensin aldosterone axis, or reduced oxidative stress [[4], [5], [6], [7]]. Recent studies have identified serum- and glucocorticoid-inducible kinase-1 (SGK1) as a pivotal player in sodium and potassium homeostasis and blood pressure regulation, via activation of the epithelial sodium channel (ENaC) [[8], [9], [10], [11], [12]]. Furthermore, dietary sodium can regulate the abundance of SGK1 in renal cells and T lymphocytes [9,13]. A better understanding of the mechanism for antihypertensive effects of potassium or resveratrol is therefore crucial for the improvement of dietary guidelines and drug development. Since potassium and sodium are the major monovalent cations that influence the formation of G-quadruplex (G4) [14], which are widely distributed in the genome and recognized as important regulators of gene expression [15], we asked if the SGK1 gene encodes any G4(s) that might be responsible for the regulation of SGK1 gene expression by sodium, potassium or resveratrol.
Section snippets
Identification of potential G4 structures in the SGK1 gene
QGRS Mapper (https://bioinformatics.ramapo.edu/QGRS/index.php) is a web-based server for predicting G-quadruplexes in nucleotide sequences [16]. We used this server to screen the promoter regions of the SGK1 gene.
DNA preparation for the biophysical studies
Three potential G4 structures in the SGK1 gene that were identified by QGRS mapper were synthesized as follows (the quadruplex-forming nucleotides are underlined):
G4-1: GGGCCGGGGTCCCGGCGGCGGGAACGGGA
G4-2: GGGTTGGGGAGGAGGGTGGGA
G4-3: GGGGCGGGGCGAGGGGCGAGGCGAAGGGCGGGA
As previously reported
The SGK1 gene contains three G4 structures in the promoter regions
We first searched for potential G4 in the promoter region of SGK1, because G4 structures are over-represented in gene promoters [22,23]. SGK1 has multiple promoters which drive the transcription of at least three isoforms [24]. By using a web-based program for predicting G4 structure [16], three G4s were identified in the SGK1(iso-1) promoter-2 region, namely G4-1, G4-2 and G4-3 (Fig. 1A). The G4-1 quadruplex sequence is conserved in human, Chimp, Gorilla, and Orangutan (Fig. 1B).
The effects of sodium, potassium and resveratrol on SGK1 G4 conformation depend on specific G4 structural features
In the
The G-quadruplex in SGK1 promoter presents a novel molecular switch in the regulation of gene expression
Potassium and sodium are the major ions that regulate the formation and folding topology of G4 [14]. G4 motifs have been identified in telomeres and promoters and implicated in variety of biological processes such as pre-mRNA splicing, transcription pausing, translation initiation and repression [15,36]. The stability and topology of G4 in the promoter may have an impact on gene expression [37]. G4 structures can be classified into three topologies, i.e., parallel, anti-parallel, and hybrid [38
Conclusion
This study provides evidence for the role of a G-quadruplex-based molecular switch for potassium or resveratrol in counteracting the effects of dietary salt, through altering the transcription of SGK1 isoforms. On the basis of this mechanism, operating on a genetic level, supplementation of potassium and a diet rich in resveratrol or possibly other DNA-binding polyphenols may be an ideal dietary salt guideline. The capacity of resveratrol to bind to G4 structures to regulate gene expression may
Declaration of Competing Interest
None.
Acknowledgments
This work was supported by grants from National Natural Science Foundation of China (NSFC) (No. 81272257 and No.31170855) to Lijun Zhao, and by an unrestricted gift to Ethan W. Taylor from the Dr. Arthur and Bonnie Ennis Foundation, Decatur, IL, USA.
References (44)
- et al.
Resveratrol prevents hypertension and cardiac hypertrophy in hypertensive rats and mice
Biochim. Biophys. Acta
(2013) - et al.
Abnormal expression of ENaC and SGK1 mRNA induced by dietary sodium in Dahl salt-sensitively hypertensive rats
Cell Biol. Int.
(2007) - et al.
Design, synthesis, biophysical and biological studies of trisubstituted naphthalimides as G-quadruplex ligands
Bioorg. Med. Chem.
(2011) - et al.
G-Quadruplexes: prediction, characterization, and biological application
Trends Biotechnol.
(2017) - et al.
Stabilization of the c-myc gene promoter quadruplex by specific ligands' inhibitors of telomerase
Biochem. Biophys. Res. Commun.
(2004) - et al.
Topologies of G-quadruplex: biological functions and regulation by ligands
Biochem. Biophys. Res. Commun.
(2020) IOM report: evidence fails to support guidelines for dietary salt reduction
JAMA
(2013)- et al.
Effect of increased potassium intake on cardiovascular risk factors and disease: systematic review and meta-analyses
BMJ
(2013) - et al.
Vegetarian diets and blood pressure: a meta-analysis
JAMA Intern. Med.
(2014) - et al.
Role of dietary potassium in the treatment of hypertension
Hypertension
(1983)
Protective effect of dietary potassium against cardiovascular damage in salt-sensitive hypertension: possible role of its antioxidant action
Curr. Vasc. Pharmacol.
Resveratrol improves vascular function in patients with hypertension and dyslipidemia by modulating NO metabolism
Hypertension
Resistance of mice lacking the serum- and glucocorticoid-inducible kinase SGK1 against salt-sensitive hypertension induced by a high-fat diet
Am. J. Physiol. Ren. Physiol.
A salt-sensing kinase in T lymphocytes, SGK1, drives hypertension and hypertensive end-organ damage
JCI Insight
Regulation of ion channels by the serum- and glucocorticoid-inducible kinase SGK1
FASEB J.
New insights into the role of serum- and glucocorticoid-inducible kinase SGK1 in the regulation of renal function and blood pressure
Curr. Opin. Nephrol. Hypertens.
High salt activates CD11c(+) antigen-presenting cells via SGK (serum glucocorticoid kinase) 1 to promote renal inflammation and salt-sensitive hypertension
Hypertension
A sodium-potassium switch in the formation of four-stranded G4-DNA
Nature
G-quadruplexes and their regulatory roles in biology
Nucleic Acids Res.
QGRS mapper: a web-based server for predicting G-quadruplexes in nucleotide sequences
Nucleic Acids Res.
Circular dichroism of G-quadruplex: a laboratory experiment for the study of topology and ligand binding
J. Chem. Educ.
A DNA polymerase stop assay for G-quadruplex-interactive compounds
Nucleic Acids Res.
Cited by (5)
Advances and prospects of natural dietary polyphenols as G-quadruplex stabilizers in biomedical applications
2024, International Journal of Biological MacromoleculesA stilbene derivative as dual-channel fluorescent probe for mitochondrial G-quadruplex DNA in living cells
2022, Spectrochimica Acta - Part A: Molecular and Biomolecular SpectroscopyCitation Excerpt :Thus, design and synthesize a fluorescent probe with dual functions of visualizing and stabilizing G-quadruplex DNA in living cell is urgent, which will provide the fundamental information for anti-cancer drug development and offer possibility for early diagnosis of cancer [21]. Resveratrol (Chart 1), a stilbene natural compound, has excellent biological activity [22], particularly anti-oxidant [23], anti-inflammatory and anti-carcinogenic properties [24]. Resveratrol presents an inhibitory activity in tumor initiation, promotion and progression [25] by inhibition of the cell cycle progression, induction of cell death [26], and suppression of angiogenesis, tumor growth and migration [27–29].
An updated pharmacological insight of resveratrol in the treatment of diabetic nephropathy
2021, GeneCitation Excerpt :It is concluded that resveratrol ameliorates glycerol-induced renal injury by balancing sodium and potassium ions in the renal system (de Jesus Soares et al., 2007). Potassium/sodium ion balance is acquired for resveratrol to attenuate the expressions of serum/glucocorticoid inducible kinase 1 (SGK1), thereby counteracting salt-sensitive hypertension (Chen et al., 2021). The defect in sodium and potassium ion balance is strongly related to diabetic nephropathy, more extensive studies are warranted to determine whether resveratrol holds promise auxiliary supplementation to the better functioning of the kidneys in diabetic patients through balancing sodium and potassium ions.
A sodium/potassium switch for G4-prone G/C-rich sequences
2024, Nucleic Acids ResearchKidney ion handling genes and their interaction in blood pressure control
2022, Bioscience Reports
- 1
These authors contributed equally.