Cooperative effects on the compaction of DNA fragments by the nucleoid protein H-NS and the crowding agent PEG probed by Magnetic Tweezers
Introduction
The compaction of DNA, and therefore its organization within the cell, is a fundamental process for the correct storage and processing of the genetic information. In prokaryotes, this crucial task is accomplished by the interplay of two major factors: macromolecular crowding and a specific class of proteins called “Nucleoid-Associated Proteins” (NAPs) [[1], [2], [3], [4], [5]]. Crowding due to the high concentration of macromolecules in a cell affects both the cytoplasm and the chromosome dynamics [[6], [7], [8], [9]], by influencing chromosome compaction through depletion-like interactions, as hypothesized previously by Odijk [10,11], and as later observed in purified nucleoids [[12], [13], [14]]. Cytoplasmic macromolecules can reach the extremely high concentration of 400 mg/ml [15] and occupy 30 − 40% of the cell volume [16,17]. As a counterpart, NAPs can induce DNA condensation and modify chromosome organization through a more direct interaction by binding to multiple sites along the DNA [[18], [19], [20], [21]]. All the NAPs recognize binding sites, in the range of 10-30 bps, at different levels of specificity, with in general an affinity for AT-rich regions [22]. In addition, NAPs can interact with DNA by different binding mechanism, such as bending, bridging or wrapping the double helix. Many NAPs participate also in the regulation of gene expression, both in a positive or negative way, by binding directly to promoter regions and by constraining DNA supercoils, thus playing a key role in determining gene-expression programs. Moreover, the combination of self-tethering (i.e. loop formation connecting two part of the same DNA filament) and crowding interactions can also affect chromosome and cytoplasm dynamics and stress propagation [9,21].
The early observation that nucleoids from NAPs mutants were still compacted by crowding lead to the hypothesis that NAPs play a small role in the compaction induced by crowding [[12], [13], [14]]. Contrary to this early speculation, recent work shows a complex interplay between NAPs and crowding (reviewed in [21]). This insight comes from studies on purified nucleoids, where crowding can be modulated in a controlled fashion by macromolecular agents that do not bind or interact directly to the DNA such as PEG [15,[23], [24], [25]], while many NAPs remain bound for relatively long times [[26], [27], [28], [29], [30]]. These studies confirm that the typical intracellular levels of crowding are sufficient to lead the chromosome close to a compact state, and they indicate a possible interplay between NAPs and depletion interactions, therefore suggesting that these two factors are not independent [28,31]. Recent evidence in this direction comes from a study on purified nucleoids and the bridging protein H-NS in the presence of crowding induced by PEG [29,32]. The authors find that the addition of H-NS affects nucleoid collapse by PEG, while H-NS alone only affects nucleoid size mildly. These results leave many open questions on the interplay of crowders with NAPs, and in particular with H-NS.
H-NS is a widespread NAP in bacteria. It is a very abundant (about 20,000 molecules per cell, equivalent to a ~20μM) small protein of 15.5 kDa, composed of a C-terminal DNA-binding domain, which binds the minor groove of the DNA, and an N-terminal dimerization domain, connected via a flexible linker [3,[33], [34], [35], [36]]. H-NS possesses two interaction surfaces that allow it to form both oligomeric structures with neighboring proteins bound along the same DNA molecule and longer range protein-protein interactions that can result in stabilization of DNA loops [35,37].
H-NS does not have a very specific consensus sequence [38,39]. However, it is well known that the binding to AT-rich regions, which exhibit a narrower minor groove, is strongly favored [40,41]. The N-terminal domain enables the formation of H-NS dimers, a protein conformation which has been demonstrated to be fundamental for the proper functionality of the protein [42].
As a NAP, H-NS encompasses both a structural role, i.e. the condensation of DNA into the bacterial nucleoid, and a regulative role, since it is involved in gene silencing, mostly for horizontally acquired genes that tend to be more AT-rich than the resident genome [1,[43], [44], [45]]. The activity of H-NS oligomers as a repressor of gene expression in AT-rich sequences may help the tolerance of recent events of horizontal gene transfer, preventing the immediate expression of foreign genes and, as a consequence, their stressful effects on cell physiology [46,47].
In order to benefit from the newly acquired genetic information, H-NS activity has to be subsequently relieved. The hindering of H-NS-mediated repression could simply result from some structural re-arrangements of the DNA itself or by the competition with other NAPs, possibly the FIS activator protein, whose binding sites in the E. coli genome are correlated to H-NS targets [48].
All these findings come from in vivo experiments or approaches based on purified nucleoids, which are subjected to a main limitation, since they cannot provide a controlled environment to stringently test the role of different players and parameters. In order to compensate for this restriction, the application of nano-manipulation techniques [[49], [50], [51]] on biomimetic systems has proven to be suitable to investigate the effects of NAPs on DNA, and in particular of H-NS [22,52,53]. Its dual bridging-binding role was thus unravelled by both Dame and Heller [[54], [55], [56]]. Additionally, single molecule Magnetic Tweezers (MT) measurements revealed an increment of DNA bending rigidity with increasing H-NS concentration, detecting a “stiffening” binding mode [57,58] likely used in gene silencing. The switch between the two binding modes was further explained as a consequence of the presence of Mg2+: if CMgCl2 < 5 mM DNA stiffening is observed, while if CMgCl2 > 5 mM DNA bridging occurs [59]. Moreover, MT measurements in condition of torsion showed that bridging-binding mechanism (resulting at high concentration of Mg2+ [59]) promotes and stabilizes the formation of plectonemes, whereas the stiffening mode influences the DNA structure by suppressing DNA supercoils [60]. Studies considering the effects of PEG on single DNA molecules found a critical concentration required for DNA condensation [25] that was inversely proportional with PEG size and ionic strength of the environment [15,23,25]. Salt concentration also has an effect on PEG-induced DNA condensation: an increase of NaCl concentration results in a decrease in the concentration of PEG necessary to induce DNA condensation [15]. Several other single-molecule studies have considered the effect of PEG on condensation in the presence of DNA intercalators, such as EtBr [61] or GelRed [62], and monovalent or divalent salts [63].
Overall, since single molecule techniques are less prone to artifacts generated by aspecific interactions, they allow a more direct and time resolved study of cooperativity compared with bulk techniques. Here, we use a MT setup to investigate the DNA extension under the effect of externally applied forces, in the presence of both H-NS, in the regime of the bridging mode, and of crowding, induced by the 1500 molecular weight PEG, (PEG1500) at various concentrations in order to obtain a clear view of the interplay of H-NS and crowding agents on DNA collapse.
Section snippets
Preparation of DNA and purification of H-NS
The DNA sample used for MT studies consists of a 4380 bp long central sequence (37% GC content) flanked by biotin- and digoxigenin-modified tails. The central sequence was obtained by PCR amplification using Q5 DNA polymerase, Lambda DNA N6-methyladenine-free (Sigma-Aldrich, st. Louis, MO) as template, and the following primers:
5′ - ACTCCCGGGTTGTGAGGCTTGCATAATGG
5′ - CTAGGGCCCAGTGAATGTCTGTTATGAGCGAGG
containing the XmaI and ApaI restriction sites respectively (bold). The two DNA tails were
Results
We investigate the structural role of H-NS and/or PEG on DNA compaction using MT, a single-molecule force spectroscopy method where the collapse/loop-formation mechanism is monitored from the extension of the DNA as a function of the external force applied on a DNA molecule (see Fig. 1). In a typical experiment, starting from the maximum applied force and gradually decreasing it, an abrupt drop in the extension of DNA occurs. At a later stage, after the consequent reduction in DNA extension,
Discussion
Our data provide evidence that the force-extension curves in the presence of H-NS alone can be rationalized by a pulled WLC with loop-forming agents at monomers localized at the higher affinity binding sites. Remarkably, at the low H-NS concentrations, we were able to show that the residual DNA lengths measured in the presence of loops match well with the location of the lowest energy binding sites of H-NS along the DNA chain.
This model also predicts the presence of hysteresis between the
Conclusions
In this work, the extension of DNA in presence of both H-NS and PEG was studied under the effect of externally applied forces, analyzing the cooperative role of H-NS and crowding agents on DNA collapse. This role could be important in an in vivo context to help maintain separate nucleoid domains, which could be “programmed” on the chromosome by the density of H-NS binding sites of different affinities, even in presence of strong depletion forces collapsing the chromosome. In such conditions,
Declaration of Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
References (83)
- et al.
The bacterial cytoplasm has glass-like properties and is fluidized by metabolic activity
Cell
(2014) Osmotic compaction of supercoiled DNA into a bacterial nucleoid
Biophys. Chem.
(1998)DNA condensation in bacteria: interplay between macromolecular crowding and nucleoid proteins
Biochimie
(2010)Studies on the compaction of isolated nucleoids from Escherichia coli
J. Struct. Biol.
(2004)Shape and compaction of Escherichia coli nucleoids
J. Struct. Biol.
(2006)Cooperative transitions of isolated Escherichia coli nucleoids: implications for the nucleoid as a cellular phase
J. Struct. Biol.
(2006)- et al.
Protein-mediated molecular bridging: a key mechanism in biopolymer organization
Biophys. J.
(2009) - et al.
Bacterial chromatin: converging views at different scales
Curr. Opin. Cell Biol.
(2016) - et al.
On the role of H-NS in the organization of bacterial chromatin: from bulk to single molecules and back
Biophys. J.
(2003) - et al.
Isolation of the Escherichia coli nucleoid
Biochimie
(2001)