Correction to: Brazilian Journal of Microbiology (2019) 50:739–748
The original version of this article unfortunately contained two mistakes in the “Materials and methods” section, subsection “DNA extraction and PCR” of the article. The correct information is given below.
1. Bacterial primer: The last paragraph of the 4th page:
Text with the wrong primer sequence: “...and 783r-CS2 (5′-ACC MGGGTATCTAATCCKG-3′)...”
The red-lettered GGTCT has to be removed.
To be corrected as (the correct sequence is): “...and 783r-CS2 (5′-ACC MGGGTATCTAATCCKG-3′)...”
2. Fungal primer: The first paragraph on page 5:
“...and CS2 (TACGGTAGCAGAGACTT) adaptors...”
GGTCT has to be added to the right end of the CS2 primer, that is, “...and CS2 (TACGGTAGCAGAGACTTGGTCT)...”
Author information
Authors and Affiliations
Corresponding author
Additional information
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
The online version of the original article can be found at https://doi.org/10.1007/s42770-019-00088-0
Rights and permissions
About this article
Cite this article
Cruz, A.F., Barka, G.D., Blum, L.E.B. et al. Correction to: Evaluation of microbial communities in peels of Brazilian tropical fruits by amplicon sequence analysis. Braz J Microbiol 51, 417 (2020). https://doi.org/10.1007/s42770-019-00187-y
Published:
Issue Date:
DOI: https://doi.org/10.1007/s42770-019-00187-y