-
H3K4 methylation regulates development, DNA repair, and virulence in Mucorales IMA Fungus (IF 5.4) Pub Date : 2024-03-14 Macario Osorio-Concepción, Carlos Lax, Damaris Lorenzo-Gutiérrez, José Tomás Cánovas-Márquez, Ghizlane Tahiri, Eusebio Navarro, Ulrike Binder, Francisco Esteban Nicolás, Victoriano Garre
Mucorales are basal fungi that opportunistically cause a potentially fatal infection known as mucormycosis (black fungus disease), which poses a significant threat to human health due to its high mortality rate and its recent association with SARS-CoV-2 infections. On the other hand, histone methylation is a regulatory mechanism with pleiotropic effects, including the virulence of several pathogenic
-
Galleria mellonella in vitro model for chromoblastomycosis shows large differences in virulence between isolates IMA Fungus (IF 5.4) Pub Date : 2024-03-08 Dongmei Shi, Zhiya Yang, Wanqing Liao, Chen Liu, Liang Zhao, Huilin Su, Xiaodong Wang, Huan Mei, Min Chen, Yinggai Song, Sybren de Hoog, Shuwen Deng
Chromoblastomycosis is the World Health Organization (WHO)-recognized fungal implantation disease that eventually leads to severe mutilation. Cladophialophora carrionii (C. carrionii) is one of the agents. However, the pathogenesis of C. carrionii is not fully investigated yet. We investigated the pathogenic potential of the fungus in a Galleria mellonella (G. mellonella) larvae infection model. Six
-
Funding for research on cryptococcal disease: an analysis based on the G-finder report IMA Fungus (IF 5.4) Pub Date : 2024-03-02 Iraine Duarte, Marcio L. Rodrigues
Members of the genus Cryptococcus are the causative agents of cryptococcal meningitis, a disease mainly associated with HIV-induced immunosuppression. Patients with cryptococcal meningitis are at a serious risk of death. Most patients suffering from cryptococcosis belong to neglected populations. With reduced support for research, new therapies are unlikely to emerge. In this essay, we used the Policy
-
Rust HUBB: DNA barcode-based identification of Pucciniales IMA Fungus (IF 5.4) Pub Date : 2024-02-25 Patricia Kaishian, Christopher R. K. Layug, Mark Anderson, Diane R. Berg, M. Catherine Aime
Rust fungi (Pucciniales, Basidiomycota) are a species-rich (ca. 8000 species), globally distributed order of obligate plant pathogens. Rust species are host-specific, and as a group they cause disease on many of our most economically and/or ecologically significant plants. As such, the ability to accurately and rapidly identify these fungi is of particular interest to mycologists, botanists, agricultural
-
Molecular phylogenetics of the Ophiocordyceps sinensis-species complex lineage (Ascomycota, Hypocreales), with the discovery of new species and predictions of species distribution IMA Fungus (IF 5.4) Pub Date : 2024-02-10 Yongdong Dai, Siqi Chen, Yuanbing Wang, Yao Wang, Zhuliang Yang, Hong Yu
Ophiocordyceps sinensis is a famous traditional Chinese medicine adapted to the alpine environment of the Qinghai-Tibet Plateau and adjacent regions. Clarification of the species diversity of Ophiocordyceps sinensis and its relatives could expand the traditional medicinal resources and provide insights into the speciation and adaptation. The study is prompted by the discovery of a new species, O. megala
-
MycoNews 2023: Editorial, news, reports, awards, personalia, and book news IMA Fungus (IF 5.4) Pub Date : 2024-02-05 David L. Hawksworth
This fifth annual edition of MycoNews starts with an editorial on the critical importance of International Mycological Congresses (IMCs) to the health of mycology. Items on Counting down to IMC12, the State of the World’s Plants and Fungi 2023, and progress towards Improving nomenclatural stability in medically important fungi follow. Reports are provided of several mycological meetings in 2023: the
-
Seasonality and intensity of airborne Boletus-type spores in relation to land use and weather pattern IMA Fungus (IF 5.4) Pub Date : 2023-12-20 Magdalena Wójcik, Idalia Kasprzyk
Forests are a natural source of airborne bolete spores. The timing of sporulation and its intensity as well as the dispersal of airborne spores and in consequence their concentrations depend in particular on the type of land use determining the availability of matter on which they develop and on meteorological factors. The aim of this study was to perform a spatial and temporal analysis of the occurrence
-
The genomes of Scedosporium between environmental challenges and opportunism IMA Fungus (IF 5.4) Pub Date : 2023-12-04 Francesco Venice, Federica Spina, Domenico Davolos, Stefano Ghignone, Giovanna Cristina Varese
Emerging fungal pathogens are a global challenge for humankind. Many efforts have been made to understand the mechanisms underlying pathogenicity in bacteria, and OMICs techniques are largely responsible for those advancements. By contrast, our limited understanding of opportunism and antifungal resistance is preventing us from identifying, limiting and interpreting the emergence of fungal pathogens
-
Detection and isolation of a new member of Burkholderiaceae-related endofungal bacteria from Saksenaea boninensis sp. nov., a new thermotolerant fungus in Mucorales IMA Fungus (IF 5.4) Pub Date : 2023-11-23 Yusuke Takashima, Kohei Yamamoto, Yousuke Degawa, Yong Guo, Tomoyasu Nishizawa, Hiroyuki Ohta, Kazuhiko Narisawa
Thermotolerance in Mucorales (Mucoromycotina) is one of the factors to be opportunistic pathogens, causing mucormycosis. Among thermotolerant mucoralean fungi, Burkholderiaceae-related endobacteria (BRE) are rarely found and the known range of hosts is limited to Rhizopus spp. The phylogenetic divergence of BRE has recently expanded in other fungal groups such as Mortierellaceae spp. (Mortierellomycotina);
-
Preliminary species diversity and community phylogenetics of wood-inhabiting basidiomycetous fungi in the Dabie Mountains, Central China reveal unexpected richness IMA Fungus (IF 5.4) Pub Date : 2023-11-14 Xiang-Yang Liu, Shi-Liang Liu, Hao-Wen Wei, Xue-Wei Wang, Jia Yu, Shan Shen, Li-Wei Zhou
Wood-inhabiting fungi have important economic values as well as playing a major ecological role in forest ecosystem cycles. The Dabie Mountains, at the junction of Henan, Hubei, and Anhui Provinces, Central China, provide an ideal climate and favorable niches for the speciation and diversification of various forms of life including fungi. We studied the species diversity and community phylogenetics
-
What can be lost? Genomic perspective on the lipid metabolism of Mucoromycota IMA Fungus (IF 5.4) Pub Date : 2023-11-06 Blanka Sokołowska, Małgorzata Orłowska, Alicja Okrasińska, Sebastian Piłsyk, Julia Pawłowska, Anna Muszewska
Mucoromycota is a phylum of early diverging fungal (EDF) lineages, of mostly plant-associated terrestrial fungi. Some strains have been selected as promising biotechnological organisms due to their ability to produce polyunsaturated fatty acids and efficient conversion of nutrients into lipids. Others get their lipids from the host plant and are unable to produce even the essential ones on their own
-
IMA genome-F18 IMA Fungus (IF 5.4) Pub Date : 2023-10-06 Cobus M. Visagie, Donato Magistà, Massimo Ferrara, Felipe Balocchi, Tuan A. Duong, Ales Eichmeier, David Gramaje, Janneke Aylward, Scott E. Baker, Irene Barnes, Sara Calhoun, Maria De Angelis, Jens C. Frisvad, Eliska Hakalova, Richard D. Hayes, Jos Houbraken, Igor V. Grigoriev, Kurt LaButti, Catarina Leal, Anna Lipzen, Vivian Ng, Jasmyn Pangilinan, Jakub Pecenka, Giancarlo Perrone, Anja Piso, Emily
Sequencing fungal genomes has now become very common and the list of genomes in this manuscript reflects this. Particularly relevant is that the first announcement is a re-identification of Penicillium genomes available on NCBI. The fact that more than 100 of these genomes have been deposited without the correct species names speak volumes to the fact that we must continue training fungal taxonomists
-
Sugarcane: an unexpected habitat for black yeasts in Chaetothyriales IMA Fungus (IF 5.4) Pub Date : 2023-10-04 Flávia de F. Costa, Rafael S. C. de Souza, Morgana F. Voidaleski, Renata R. Gomes, Guilherme F. Reis, Bruna J. F. de S. Lima, Giovanna Z. Candido, Marlon R. Geraldo, Jade M. B. Soares, Gabriela X. Schneider, Edvaldo da S. Trindade, Israel H. Bini, Leandro F. Moreno, Amanda Bombassaro, Flávio Queiroz-Telles, Roberto T. Raittz, Yu Quan, Paulo Arruda, Derlene Attili-Angelis, Sybren de Hoog, Vania A. Vicente
Sugarcane (Saccharum officinarum, Poaceae) is cultivated on a large scale in (sub)tropical regions such as Brazil and has considerable economic value for sugar and biofuel production. The plant is a rich substrate for endo- and epiphytic fungi. Black yeasts in the family Herpotrichiellaceae (Chaetothyriales) are colonizers of human-dominated habitats, particularly those rich in toxins and hydrocarbon
-
Evidence that the domesticated fungus Leucoagaricus gongylophorus recycles its cytoplasmic contents as nutritional rewards to feed its leafcutter ant farmers IMA Fungus (IF 5.4) Pub Date : 2023-09-15 Caio Ambrosio Leal-Dutra, Lok Man Yuen, Bruno Augusto Maciel Guedes, Marta Contreras-Serrano, Pedro Elias Marques, Jonathan Zvi Shik
Leafcutter ants farm a fungal cultivar (Leucoagaricus gongylophorus) that converts inedible vegetation into food that sustains colonies with up to millions of workers. Analogous to edible fruits of crops domesticated by humans, L. gongylophorus has evolved specialized nutritional rewards—swollen hyphal cells called gongylidia that package metabolites and are consumed by ant farmers. Yet, little is
-
Targeted sequencing analysis pipeline for species identification of human pathogenic fungi using long-read nanopore sequencing IMA Fungus (IF 5.4) Pub Date : 2023-09-06 Nattapong Langsiri, Navaporn Worasilchai, Laszlo Irinyi, Piroon Jenjaroenpun, Thidathip Wongsurawat, Janet Jennifer Luangsa-ard, Wieland Meyer, Ariya Chindamporn
Among molecular-based techniques for fungal identification, Sanger sequencing of the primary universal fungal DNA barcode, the internal transcribed spacer (ITS) region (ITS1, 5.8S, ITS2), is commonly used in clinical routine laboratories due to its simplicity, universality, efficacy, and affordability for fungal species identification. However, Sanger sequencing fails to identify mixed ITS sequences
-
Fucose as a nutrient ligand for Dikarya and a building block of early diverging lineages IMA Fungus (IF 5.4) Pub Date : 2023-09-05 Małgorzata Orłowska, Drishtee Barua, Sebastian Piłsyk, Anna Muszewska
Fucose is a deoxyhexose sugar present and studied in mammals. The process of fucosylation has been the primary focus in studies relating to fucose in animals due to the presence of fucose in Lewis antigens. Very few studies have reported its presence in Fungi, mostly in Mucoromycotina. The constitution of 25% and 12% of this sugar in the carbohydrates of cell wall in the respective Umbelopsis and Mucorales
-
New Resinogalea species from Araucaria araucana resin in Chile and reclassification of the genus in the Cryptocaliciomycetidae IMA Fungus (IF 5.4) Pub Date : 2023-08-18 Felipe Balocchi, Irene Barnes, Michael J. Wingfield, Rodrigo Ahumada, Cobus M. Visagie
Araucaria araucana is an ancient conifer, native to the mountain ranges in Chile and Argentina. These trees host a large number of organisms, mainly insects, strongly or even exclusively associated with them. The recent emergence of a novel canker disease on A. araucana has emphasised the importance of fungi associated with these iconic trees and has resulted in the discovery of various new species
-
Genomic characterization and radiation tolerance of Naganishia kalamii sp. nov. and Cystobasidium onofrii sp. nov. from Mars 2020 mission assembly facilities IMA Fungus (IF 5.4) Pub Date : 2023-08-11 Patrick Leo, Marcus de Melo Texeira, Atul M. Chander, Nitin K. Singh, Anna C. Simpson, Andrey Yurkov, Fathi Karouia, Jason E. Stajich, Christopher E. Mason, Kasthuri Venkateswaran
During the construction and assembly of the Mars 2020 mission components at two different NASA cleanrooms, several fungal strains were isolated. Based on their colony morphology, two strains that showed yeast-like appearance were further characterized for their phylogenetic position. The species-level classification of these two novel strains, using traditional colony and cell morphology methods combined
-
Human adaptation and diversification in the Microsporum canis complex IMA Fungus (IF 5.4) Pub Date : 2023-07-24 Xin Zhou, Sarah A. Ahmed, Chao Tang, Maria Eduarda Grisolia, José Francisco Ghignatti Warth, Kristen Webster, Andrea Peano, Silke Uhrlass, Claudia Cafarchia, Marie Pierre Hayette, Rosalie Sacheli, Tadeja Matos, Yingqian Kang, G. Sybren de Hoog, Peiying Feng
The Microsporum canis complex consists of one zoophilic species, M. canis, and two anthropophilic species, M. audouinii and M. ferrugineum. These species are the most widespread zoonotic pathogens causing dermatophytosis in cats and humans worldwide. To clarify the evolutionary relationship between the three species and explore the potential host shift process, this study used phylogenetic analysis
-
Mitochondrial genome of Cordyceps blackwelliae: organization, transcription, and evolutionary insights into Cordyceps IMA Fungus (IF 5.4) Pub Date : 2023-07-06 Yong-Jie Zhang, Xiang-Ping Fan, Jia-Ni Li, Shu Zhang
Cordyceps is a diverse genus of insect pathogenic fungi, with about 180 accepted species, including some well-known ones used as ethnic medicine and/or functional food. Nevertheless, mitogenomes are only available for four members of the genus. The current study reports the mitogenome of Cordyceps blackwelliae, a newly described entomopathogenic fungus. The 42,257-bp mitogenome of the fungus encoded
-
Validation of Fuscoporia (Hymenochaetales, Basidiomycota) ITS sequences and five new species based on multi-marker phylogenetic and morphological analyses IMA Fungus (IF 5.4) Pub Date : 2023-06-28 Yoonhee Cho, Dohye Kim, Yoongil Lee, Juhwan Jeong, Shahid Hussain, Young Woon Lim
Although there is a continuous increase in available molecular data, not all sequence identities in public databases are always properly verified and managed. Here, the sequences available in GenBank for Fuscoporia (Hymenochaetales) were validated. Many morphological characters of Fuscoporia overlap among the species, emphasizing the role of molecular identification for accuracy. The identities of
-
Taxonomy of Hyphodermella: a case study to show that simple phylogenies cannot always accurately place species in appropriate genera IMA Fungus (IF 5.4) Pub Date : 2023-06-06 Shan Shen, Shi-Liang Liu, Li-Wei Zhou
The genus is a special and crucial taxonomic rank compared with others above the species level, because a species has to be placed in a certain genus instead of any other higher ranks. With more and more new species being described, the placements of their generic position are sometimes incorrect due to the simple phylogenies resulting from inappropriate sampling. Here, we focus on the taxonomy of
-
Endophytic fungi related to the ash dieback causal agent encode signatures of pathogenicity on European ash IMA Fungus (IF 5.4) Pub Date : 2023-05-11 Maryam Rafiqi, Chatchai Kosawang, Jessica A. Peers, Lukas Jelonek, Hélène Yvanne, Mark McMullan, Lene R. Nielsen
Tree diseases constitute a significant threat to biodiversity worldwide. Pathogen discovery in natural habitats is of vital importance to understanding current and future threats and prioritising efforts towards developing disease management strategies. Ash dieback is a fungal disease of major conservational concern that is infecting common ash trees, Fraxinus excelsior, in Europe. The disease is caused
-
Six new species of zombie-ant fungi from Yunnan in China IMA Fungus (IF 5.4) Pub Date : 2023-05-11 Dexiang Tang, Ou Huang, Weiqiu Zou, Yuanbing Wang, Yao Wang, Quanying Dong, Tao Sun, Gang Yang, Hong Yu
Some Ophiocordyceps species infecting ants are able to manipulate the host behavior. The hosts are manipulated in order to move to location that are advantageous for fungal spore transmission. Ophiocordyceps species that are able to manipulate the ant's behavior are called "zombie-ant fungi". They are widespread within tropical forests worldwide, with relatively few reports from subtropical monsoon
-
Rearranging the Bird’s Nest Fungi: molecular review of internal clades in Cyathus (Nidulariaceae, Basidiomycota) IMA Fungus (IF 5.4) Pub Date : 2023-04-07 Rhudson Henrique Santos Ferreira da Cruz, Jefferson dos Santos Góis, Paulo Marinho, Iuri Goulart Baseia, Kentaro Hosaka
The genus Cyathus was established in 1768, but more in-depth taxonomic studies with the group only occurred after 1844. In the following years, changes in the infrageneric classification of Cyathus were proposed based mainly on morphology. With advances in phylogenetic studies, the morphological classifications were tested and a new subdivision into three groups was proposed in 2007. Based on the last
-
The first two mitochondrial genomes from Apiotrichum reveal mitochondrial evolution and different taxonomic assignment of Trichosporonales IMA Fungus (IF 5.4) Pub Date : 2023-03-31 Qiang Li, Wenqi Xiao, Peng Wu, Ting Zhang, Peng Xiang, Qian Wu, Liang Zou, Mingying Gui
Apiotrichum is a diverse anamorphic basidiomycetous yeast genus, and its mitogenome characterization has not been revealed. In this study, we assembled two Apiotrichum mitogenomes and compared them with mitogenomes from Agaricomycotina, Pucciniomycotina and Ustilaginomycotina. The mitogenomes of Apiotrichum gracile and A. gamsii comprised circular DNA molecules, with sizes of 34,648 bp and 38,096 bp
-
Polydomus karssenii gen. nov. sp. nov. is a dark septate endophyte with a bifunctional lifestyle parasitising eggs of plant parasitic cyst nematodes (Heterodera spp.) IMA Fungus (IF 5.4) Pub Date : 2023-03-30 Samad Ashrafi, Jan-Peer Wennrich, Yvonne Becker, Jose G. Maciá-Vicente, Anke Brißke-Rode, Matthias Daub, Torsten Thünen, Abdelfattah A. Dababat, Maria R. Finckh, Marc Stadler, Wolfgang Maier
In this study fungal strains were investigated, which had been isolated from eggs of the cereal cyst nematode Heterodera filipjevi, and roots of Microthlaspi perfoliatum (Brassicaceae). The morphology, the interaction with nematodes and plants and the phylogenetic relationships of these strains originating from a broad geographic range covering Western Europe to Asia Minor were studied. Phylogenetic
-
A contribution to Porogramme (Polyporaceae, Agaricomycetes) and related genera IMA Fungus (IF 5.4) Pub Date : 2023-03-07 Wei-Lin Mao, Ying-Da Wu, Hong-Gao Liu, Yuan Yuan, Yu-Cheng Dai
The polypores with shallow pores from tropical Asia and America are studied. Our molecular phylogeny based on the internal transcribed spacer (ITS), the large subunit nuclear ribosomal RNA gene (nLSU), the translation elongation factor 1-α gene (TEF1), and the largest subunit of RNA polymerase II (RPB1) demonstrates six clades are formed among Porogramme and related genera. Two new genera, Cyanoporus
-
Phylogeography and population structure of the global, wide host-range hybrid pathogen Phytophthora × cambivora IMA Fungus (IF 5.4) Pub Date : 2023-02-23 Martin S. Mullett, Kris Van Poucke, Annelies Haegeman, Fran Focquet, Nicholas C. Cauldron, Brian J. Knaus, Marilia Horta Jung, Koji Kageyama, Ayaka Hieno, Hayato Masuja, Seiji Uematsu, Joan F. Webber, Clive M. Brasier, József Bakonyi, Kurt Heungens, Niklaus J. Grünwald, Thomas Jung
Invasive, exotic plant pathogens pose a major threat to native and agricultural ecosystems. Phytophthora × cambivora is an invasive, destructive pathogen of forest and fruit trees causing severe damage worldwide to chestnuts (Castanea), apricots, peaches, plums, almonds and cherries (Prunus), apples (Malus), oaks (Quercus), and beech (Fagus). It was one of the first damaging invasive Phytophthora species
-
Comparative genomic study of the Penicillium genus elucidates a diverse pangenome and 15 lateral gene transfer events IMA Fungus (IF 5.4) Pub Date : 2023-02-01 Celine Petersen, Trine Sørensen, Mikkel R. Nielsen, Teis E. Sondergaard, Jens L. Sørensen, David A. Fitzpatrick, Jens C. Frisvad, Kåre L. Nielsen
The Penicillia are known to produce a wide range natural products—some with devastating outcome for the agricultural industry and others with unexploited potential in different applications. However, a large-scale overview of the biosynthetic potential of different species has been lacking. In this study, we sequenced 93 Penicillium isolates and, together with eleven published genomes that hold similar
-
First genome-scale insights into the virulence of the snow mold causal fungus Microdochium nivale IMA Fungus (IF 5.4) Pub Date : 2023-01-10 Tsers, Ivan, Marenina, Ekaterina, Meshcherov, Azat, Petrova, Olga, Gogoleva, Olga, Tkachenko, Alexander, Gogoleva, Natalia, Gogolev, Yuri, Potapenko, Evgenii, Muraeva, Olga, Ponomareva, Mira, Korzun, Viktor, Gorshkov, Vladimir
Pink snow mold, caused by a phytopathogenic and psychrotolerant fungus, Microdochium nivale, is a severe disease of winter cereals and grasses that predominantly occurs under snow cover or shortly after its melt. Snow mold has significantly progressed during the past decade, often reaching epiphytotic levels in northern countries and resulting in dramatic yield losses. In addition, M. nivale gradually
-
MycoNews 2022: editorial, news, reports, awards, personalia, and book news IMA Fungus (IF 5.4) Pub Date : 2023-01-09 Hawksworth, David L.
This fourth annual edition of MycoNews starts with an editorial asking if mycology is approaching a tipping point, and note of the journal’s 2021 Impact Factor almost doubling from 2020. Updated information and new speakers for IMC12 in 2024 is presented. Reports are provided for the Rise of the Fungi symposium in Amsterdam and of MycoRiseUP! in Warsaw in 2022. Information on activities of the International
-
IMA genome‑F17 IMA Fungus (IF 5.4) Pub Date : 2022-11-21 Wingfield, Brenda D., Berger, Dave K., Coetzee, Martin P. A., Duong, Tuan A., Martin, Anke, Pham, Nam Q., van den Berg, Noelani, Wilken, P. Markus, Arun-Chinnappa, Kiruba Shankari, Barnes, Irene, Buthelezi, Sikelela, Dahanayaka, Buddhika Amarasinghe, Durán, Alvaro, Engelbrecht, Juanita, Feurtey, Alice, Fourie, Arista, Fourie, Gerda, Hartley, Jesse, Kabwe, Eugene N. K., Maphosa, Mkhululi, Narh Mensah
Draft genome sequence of an Armillaria species from Zimbabwe Introduction The genus Armillaria includes at least 38 species, most of which are facultative necrotrophs (Gregory and Rishbeth 1991). Pathogenicity of these organisms can result in Armillaria root and stem rot and what is referred to as shoestring root rot (Morrison 1991). This disease can bring about massive devastation to woody plants
-
Demystifying Hebeloma: introducing hebeloma.org and its database IMA Fungus (IF 5.4) Pub Date : 2022-11-09 Bartlett, Peter, Eberhardt, Ursula, Beker, Henry J.
We here announce the launch of the website https://hebeloma.org .
-
A re-assessment of Taxomyces andreanae, the alleged taxol-producing fungus, using comparative genomics IMA Fungus (IF 5.4) Pub Date : 2022-09-26 Cheng, Tian, Kolařík, Miroslav, Quijada, Luis, Stadler, Marc
The monotypic “bulbilliferous hyphomycete” genus Taxomyces was erected in 1993 for a fungal endophyte isolated from the Yew tree Taxus brevifolia and named Taxomyces andreanae. This fungus was reported to produce the plant-derived anti-cancer drug taxol. The original description of the fungus was not conclusive as to its taxonomic position because no sporulation or other salient morphological features
-
The first two mitochondrial genomes for the genus Ramaria reveal mitochondrial genome evolution of Ramaria and phylogeny of Basidiomycota IMA Fungus (IF 5.4) Pub Date : 2022-09-13 Li, Qiang, Li, Lijiao, Zhang, Ting, Xiang, Peng, Wu, Qian, Tu, Wenying, Bao, Zhijie, Zou, Liang, Chen, Cheng
In the present study, we assembled and analyzed the mitogenomes of two Ramaria species. The assembled mitogenomes of Ramaria cfr. rubripermanens and R. rubella were circularized, with sizes of 126,497 bp and 143,271 bp, respectively. Comparative mitogenome analysis showed that intron region contributed the most (contribution rate, 43.74%) to the size variations of Ramaria mitogenomes. The genetic contents
-
Cadophora species from marine glaciers in the Qinghai-Tibet Plateau: an example of unsuspected hidden biodiversity IMA Fungus (IF 5.4) Pub Date : 2022-09-05 Zhang, Bingqian, Li, Xiaoguang, Li, Guojie, Wang, Qi-Ming, Wang, Manman
Large numbers of marine glaciers in the Qinghai-Tibet Plateau are especially sensitive to changes of climate and surface conditions. They have suffered fast accumulation and melting and retreated quickly in recent years. In 2017, we surveyed the cold-adapted fungi in these unique habitats and obtained 1208 fungal strains. Based on preliminary analysis of ITS sequences, 41 isolates belonging to the
-
Importance of appropriate genome information for the design of mating type primers in black and yellow morel populations IMA Fungus (IF 5.4) Pub Date : 2022-08-22 Cravero, Melissa, Robinson, Aaron J., Hilpisch, Patrick, Chain, Patrick S., Bindschedler, Saskia, Junier, Pilar
Morels are highly prized edible fungi where sexual reproduction is essential for fruiting-body production. As a result, a comprehensive understanding of their sexual reproduction is of great interest. Central to this is the identification of the reproductive strategies used by morels. Sexual reproduction in fungi is controlled by mating-type (MAT) genes and morels are thought to be mainly heterothallic
-
Species determination using AI machine-learning algorithms: Hebeloma as a case study IMA Fungus (IF 5.4) Pub Date : 2022-06-30 Bartlett, Peter, Eberhardt, Ursula, Schütz, Nicole, Beker, Henry J.
The genus Hebeloma is renowned as difficult when it comes to species determination. Historically, many dichotomous keys have been published and used with varying success rate. Over the last 20 years the authors have built a database of Hebeloma collections containing not only metadata but also parametrized morphological descriptions, where for about a third of the cases micromorphological characters
-
Phytophthora: an ancient, historic, biologically and structurally cohesive and evolutionarily successful generic concept in need of preservation IMA Fungus (IF 5.4) Pub Date : 2022-06-27 Brasier, Clive, Scanu, Bruno, Cooke, David, Jung, Thomas
The considerable economic and social impact of the oomycete genus Phytophthora is well known. In response to evidence that all downy mildews (DMs) reside phylogenetically within Phytophthora, rendering Phytophthora paraphyletic, a proposal has been made to split the genus into multiple new genera. We have reviewed the status of the genus and its relationship to the DMs. Despite a substantial increase
-
Comparative genomics reveals low levels of inter- and intraspecies diversity in the causal agents of dwarf and common bunt of wheat and hint at conspecificity of Tilletia caries and T. laevis IMA Fungus (IF 5.4) Pub Date : 2022-06-07 Sedaghatjoo, Somayyeh, Mishra, Bagdevi, Forster, Monika K., Becker, Yvonne, Keilwagen, Jens, Killermann, Berta, Thines, Marco, Karlovsky, Petr, Maier, Wolfgang
Tilletia caries and T. laevis, which are the causal agents of common bunt, as well as T. controversa, which causes dwarf bunt of wheat, threaten especially organic wheat farming. The three closely related fungal species differ in their teliospore morphology and partially in their physiology and infection biology. The gene content as well as intraspecies variation in these species and the genetic basis
-
Correction to: Heterothallism and potential hybridization events inferred for twenty-two yellow morel species IMA Fungus (IF 5.4) Pub Date : 2022-05-19 Du, Xi-Hui, Wu, Dongmei, Kang, Heng, Wang, Hanchen, Xu, Nan, Li, Tingting, Chen, Keliang
Following the publication of the original article (Du et al. 2020), we were notified of two mistaken pairs of primer sequences in Table 2, as shown below. Incorrect sequence: Corrected sequence: EMAT1–1L: TGAGTCCGTTATGATTCTGG EMAT1–1R: GGACCATTCGCTTTCTCATA EMAT1–2L: GATATGCTCACCAACCGTAA EMAT1–2R: TACGATCGAATAATGGCTCC The original article has been corrected. Du X-H et al (2020) Heterothallism and potential
-
Correction to: The genus Arthrinium (Ascomycota, Sordariomycetes, Apiosporaceae) from marine habitats from Korea, with eight new species IMA Fungus (IF 5.4) Pub Date : 2022-05-16 Kwon, Michael Sun Lul, Park, Myung Soo, Jang, Seokyoon, Lee, Young Min, Heo, Young Mok, Hong, Joo-Hyun, Lee, Hanbyul, Jang, Yeongseon, Park, Ji-Hyun, Kim, Changmu, Kim, Gyu-Hyeok, Woon Lim, Young, Kim, Jae-Jin
Following the publication of the original article (Kwon et al. 2021), we were notified that Figs. 6 and 7 have been swapped. Figure 6 actually depicts the Arthrinium marinum, while Fig. 7 shows Arthrinium koreanum. The original article has been corrected. Kwon et al. (2021) The genus Arthrinium (Ascomycota, Sordariomycetes, Apiosporaceae) from marine habitats from Korea, with eight new species (2021)
-
Medicinal, nutritional, and nutraceutical potential of Sparassis crispa s. lat.: a review IMA Fungus (IF 5.4) Pub Date : 2022-05-06 Sharma, Neha, Tapwal, Ashwani, Verma, Rachna, Kumar, Dinesh, Nepovimova, Eugenie, Kuca, Kamil
Sparassis crispa is an edible mushroom exhibiting a wide range of medicinal properties. It is recognized for therapeutic value because of the high β-glucan content in the basidiomes. The broad range of its reported curative effects include anti-tumour, anti-cancer, immune-enhancing, hematopoietic, anti-angiogenic, anti-inflammatory, anti-diabetic, wound-healing, antioxidant, anti-coagulant, and anti-hypertensive
-
First two mitochondrial genomes for the order Filobasidiales reveal novel gene rearrangements and intron dynamics of Tremellomycetes IMA Fungus (IF 5.4) Pub Date : 2022-05-02 Li, Qiang, Bao, Zhijie, Tang, Ke, Feng, Huiyu, Tu, Wenying, Li, Lijiao, Han, Yunlei, Cao, Mei, Zhao, Changsong
In the present study, two mitogenomes from the Filobasidium genus were assembled and compared with other Tremellomycetes mitogenomes. The mitogenomes of F. wieringae and F. globisporum both comprised circular DNA molecules, with sizes of 27,861 bp and 71,783 bp, respectively. Comparative mitogenomic analysis revealed that the genetic contents, tRNAs, and codon usages of the two Filobasidium species
-
Fungal and oomycete pathogens and heavy metals: an inglorious couple in the environment IMA Fungus (IF 5.4) Pub Date : 2022-04-25 Gajewska, Joanna, Floryszak-Wieczorek, Jolanta, Sobieszczuk-Nowicka, Ewa, Mattoo, Autar, Arasimowicz-Jelonek, Magdalena
Heavy metal (HM) contamination of the environment is a major problem worldwide. The rate of global deposition of HMs in soil has dramatically increased over the past two centuries and there of facilitated their rapid accumulation also in living systems. Although the effects of HMs on plants, animals and humans have been extensively studied, yet little is known about their effects on the (patho)biology
-
A severe microsporidian disease in cultured Atlantic Bluefin Tuna (Thunnus thynnus) IMA Fungus (IF 5.4) Pub Date : 2022-03-11 López-Verdejo, Alejandro, Montero, Francisco E., de la Gándara, Fernando, Gallego, Miguel A., Ortega, Aurelio, Raga, Juan Antonio, Palacios-Abella, José F.
One of the most promising aquaculture species is the Atlantic bluefin tuna (Thunnus thynnus) with high market value; disease control is crucial to prevent and reduce mortality and monetary losses. Microsporidia (Fungi) are a potential source of damage to bluefin tuna aquaculture. A new microsporidian species is described from farmed bluefin tunas from the Spanish Mediterranean. This new pathogen is
-
Black fungi and ants: a genomic comparison of species inhabiting carton nests versus domatia IMA Fungus (IF 5.4) Pub Date : 2022-03-07 Quan, Yu, da Silva, Nickolas Menezes, de Souza Lima, Bruna Jacomel Favoreto, de Hoog, Sybren, Vicente, Vania Aparecida, Mayer, Veronika, Kang, Yingqian, Shi, Dongmei
Some members of Chaetothyriales, an order containing potential agents of opportunistic infections in humans, have a natural habitat in nests of tropical arboreal ants. In these black fungi, two types of ant symbiosis are known, i.e. occurrence in domatia inside living plants, or as components of carton constructions made of ant-chewed plant tissue. In order to explain differences between strains from
-
IMA Genome - F16 IMA Fungus (IF 5.4) Pub Date : 2022-02-23 Wingfield, Brenda D., De Vos, Lieschen, Wilson, Andi M., Duong, Tuan A., Vaghefi, Niloofar, Botes, Angela, Kharwar, Ravindra Nath, Chand, Ramesh, Poudel, Barsha, Aliyu, Habibu, Barbetti, Martin J., Chen, ShuaiFei, de Maayer, Pieter, Liu, FeiFei, Navathe, Sudhir, Sinha, Shagun, Steenkamp, Emma T., Suzuki, Hiroyuki, Tshisekedi, Kalonji A., van der Nest, Magriet A., Wingfield, Michael J.
Draft genome assembly of Fusarium marasasianum Introduction Many plants are thought to have at least one Fusarium-associated disease with more than 80% of economically important plants affected by at least one Fusarium disease (Leslie and Summerell 2006). The socioeconomic importance of Fusarium is particularly evident when considering the Fusarium fujikuroi species complex (FFSC, sensu Geiser et al
-
Epichloë scottii sp. nov., a new endophyte isolated from Melica uniflora is the missing ancestor of Epichloë disjuncta IMA Fungus (IF 5.4) Pub Date : 2022-02-03 Thünen, Torsten, Becker, Yvonne, Cox, Murray P., Ashrafi, Samad
Here we describe a new, haploid and stroma forming species within the genus Epichloë, as Epichloë scottii sp. nov. The fungus was isolated from Melica uniflora growing in Bad Harzburg, Germany. Phylogenetic reconstruction using a combined dataset of the tubB and tefA genes strongly support that E. scottii is a distinct species and the so far unknown ancestor species of the hybrid E. disjuncta. A distribution
-
The haustorium as a driving force for speciation in thallus-forming Laboulbeniomycetes IMA Fungus (IF 5.4) Pub Date : 2022-01-31 Haelewaters, Danny, Lubbers, Maarten, De Kesel, André
Laboulbeniomycetes is a class of fungi that have obligate associations with arthropod hosts, either for dispersal (order Pyxidiophorales) or as biotrophic parasites (orders Herpomycetales and Laboulbeniales). Here, we focus on Herpomycetales and Laboulbeniales, which include fungi that form thalli, 3-dimensional, multicellular units of 1000 s of cells. Based on recently published data regarding patterns
-
MycoNews 2021: President’s message, IMA statutes, news, reports, awards, personalia, and book news IMA Fungus (IF 5.4) Pub Date : 2021-12-31 Hawksworth, David L.
This third annual edition of MycoNews starts with a message from IMA President Wieland Meyer regarding the adoption of new statutes for the IMA, the postponement of IMC12 to 2024, and announcing Marc Stadler as President-elect. The new statutes are included in full. News is provided on the launch of a World Fungus Day, acceptance of the term Funga as an equivalent to Fauna and Flora by the IUCN Species
-
Genetic structure and evolutionary diversity of mating-type (MAT) loci in Hypsizygus marmoreus IMA Fungus (IF 5.4) Pub Date : 2021-12-20 Wang, Gang, Wang, Yuanyuan, Chen, Lianfu, Wang, Hongbo, Guo, Lin, Zhou, Xuan, Dou, Meijie, Wang, Baiyu, Lin, Jingxian, Liu, Lei, Wang, Zhengchao, Deng, Youjin, Zhang, Jisen
The mating compatibility in fungi is generally governed by genes located within a single or two unlinked mating type (MAT) loci. Hypsizygus marmoreus is an edible mushroom in the order Agaricales with a tetrapolar system, which contains two unlinked MAT loci-homeodomain (HD) transcription factor genes and pheromone/pheromone receptor genes (P/R). In this study, we analyzed the genetic structure and
-
The genus Entomophthora: bringing the insect destroyers into the twenty-first century IMA Fungus (IF 5.4) Pub Date : 2021-11-12 Elya, Carolyn, De Fine Licht, Henrik H.
The fungal genus Entomophthora consists of highly host-specific pathogens that cause deadly epizootics in their various insect hosts. The most well-known among these is the “zombie fly” fungus E. muscae, which, like other Entomophthora species, elicits a series of dramatic behaviors in infected hosts to promote optimal spore dispersal. Despite having been first described more than 160 years ago, there
-
Melanin production and laccase mediated oxidative stress alleviation during fungal-fungal interaction among basidiomycete fungi IMA Fungus (IF 5.4) Pub Date : 2021-11-09 Dullah, Samim, Hazarika, Dibya Jyoti, Goswami, Gunajit, Borgohain, Tanushree, Ghosh, Alokesh, Barooah, Madhumita, Bhattacharyya, Ashok, Boro, Robin Chandra
Fungal-fungal interaction often leads to the change in metabolite profile of both the interacting fungus which may have potential implication in industry or agriculture. In the present study, we performed two sets of fungal-fungal interaction—Trametes coccinea (F3) with Leiotrametes lactinea (F9) and T. coccinea (F3) with T. versicolor (F1) to understand the changes in the metabolite profile during
-
Fungal genomes: suffering with functional annotation errors IMA Fungus (IF 5.4) Pub Date : 2021-11-01 Mohanta, Tapan Kumar, Al-Harrasi, Ahmed
The genome sequence data of more than 65985 species are publicly available as of October 2021 within the National Center for Biotechnology Information (NCBI) database alone and additional genome sequences are available in other databases and also continue to accumulate at a rapid pace. However, an error-free functional annotation of these genome is essential for the research communities to fully utilize
-
The complete mitochondrial genome of Ophiocordyceps gracilis and its comparison with related species IMA Fungus (IF 5.4) Pub Date : 2021-10-20 Abuduaini, Aifeire, Wang, Yuan-Bing, Zhou, Hui-Ying, Kang, Rui-Ping, Ding, Ming-Liang, Jiang, Yu, Suo, Fei-Ya, Huang, Luo-Dong
In this study, the complete mitochondrial genome of O. gracilis was sequenced and assembled before being compared with related species. As the second largest mitogenome reported in the family Ophiocordycipitaceae, the mitogenome of O. gracilis (voucher OG201301) is a circular DNA molecule of 134,288 bp that contains numerous introns and longer intergenomic regions. UCA was detected as anticodon in
-
IMA Genome - F15 IMA Fungus (IF 5.4) Pub Date : 2021-10-13 Duong, Tuan Anh, Aylward, Janneke, Ametrano, Claudio Gennaro, Poudel, Barsha, Santana, Quentin Carlo, Wilken, Pieter Markus, Martin, Anke, Arun-Chinnappa, Kiruba Shankari, de Vos, Lieschen, DiStefano, Isabel, Grewe, Felix, Huhndorf, Sabine, Lumbsch, Helge Thorsten, Rakoma, Jostina Raesetsa, Poudel, Barsha, Steenkamp, Emma Theodora, Sun, Yukun, van der Nest, Magriet A., Wingfield, Michael John, Yilmaz
Draft genome assembly of Fusarium pilosicola Introduction The Fusarium fujikuroi species complex (FFSC) is a diverse group of fungi with diverse ecologies that range from inhabiting soil to causing disease on a variety of plants (Kvas et al. 2009; Yilmaz et al. 2021). Members of this genus are also known for producing mycotoxins that are harmful to both human and animal health (Summerell 2019). Due
-
Fungi of entomopathogenic potential in Chytridiomycota and Blastocladiomycota, and in fungal allies of the Oomycota and Microsporidia IMA Fungus (IF 5.4) Pub Date : 2021-10-11 Kaczmarek, Agata, Boguś, Mieczysława I.
The relationship between entomopathogenic fungi and their insect hosts is a classic example of the co-evolutionary arms race between pathogen and target host. The present review describes the entomopathogenic potential of Chytridiomycota and Blastocladiomycota fungi, and two groups of fungal allies: Oomycota and Microsporidia. The Oomycota (water moulds) are considered as a model biological control
-
Correction to: Enlightening the black and white: species delimitation and UNITE species hypothesis testing in the Russula albonigra species complex IMA Fungus (IF 5.4) Pub Date : 2021-10-04 De Lange, Ruben, Adamčík, Slavomír, Adamčíkova, Katarína, Asselman, Pieter, Borovička, Jan, Delgat, Lynn, Hampe, Felix, Verbeken, Annemieke
Following the publication of the original article [1], we were notified of a few inconsistencies between the pdf version and the html version with regards to the Key to the European species of Russula subgen. Compactae (pg. 25). • In the online version for steps 3(2), 9(8) and 12(10): part of first option was gone and combined with the second option. •In the online version for step 13(12), both options