Abstract Chlorpyrifos is an organophosphate and the cypermethrin is type 2 pyrethroid insecticide that are used for indoor and outdoor pest control. The present study aimed to investigate differential transcriptional profiling to identify the candidate gene associated with lung injury following exposure to chlorpyrifos and/or cypermethrin in a mouse model system. Swiss male albino mice (n = 24) were

Abstract Accurate and rapid determination of bacterial disease agents of fish is an important step for sustainable and efficient aquaculture production. In general, biochemical and molecular methods are used for pathogen detection but they are usually time-consuming and required qualified personnel. Recently spectroscopic methods are preferred in clinical and food microbiology and declared as a promising

Abstract The commercial production of halal and kosher meat and controversy surrounding the slaughter without stunning is rapidly growing across the globe. Huge global market for halal and kosher meat warrants conciliation of religious practices and animal welfare for the betterment of meat industry. In the present study, we investigated changes in muscle proteome of sheep (Ovis aries) subjected to

Abstract The main objective of this study was to investigate the expression of acrosin inhibitor (AI), ubiquitin (Ub), and small ubiquitin-related modifier 1 (SUMO1) proteins during in vitro capacitation of pig sperm. Duroc pig sperm was divided into fresh sperm and capacitation treatment groups. Protein expression was evaluated using computer-assisted sperm analysis (CASA) systems, sodium dodecyl

Abstract This study aimed to evaluate the immune effects of compound astragalus polysaccharide and sulfated epimedium polysaccharide (APS-sEPS) on the peripheral blood lymphocyte and intestinal mucosa in newborn piglets. A total of 40 newborn piglets were randomly divided into four groups during a 25-day experiment, including APS-sEPS, APS, sEPS and control group. The results showed that supplementation

Abstract Circular RNAs (circRNAs), a novel class of non-coding RNAs, can interact with miRNAs through a sequence-driven sponge mechanism, thereby regulating the expression of their downstream target genes. CircRNA-1967 was found in secondary hair follicles (SHFs) of cashmere goats, but its functions are not clear. Here, we showed that both circRNA-1967 and its host gene BNC2 had significantly higher

Abstract Sidekick cell adhesion molecule 1 (SDK1) gene belonging to the immunoglobulin superfamily (IgSF) is reported to be associated with disease resistance. A novel missense mutation (XM_015469413.1: c.2678 A > G: p. Asp893Gly) in bovine SDK1 gene was observed in the Bovine Genome Variation Database (BGVD). The purpose of the current study was to determine the allelic frequency distribution of XM_015469413

Abstract The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The

Abstract To investigate the effects of dietary leucine supplementation on muscle fiber type transformation in weaning piglets, 54 21-day-old male DLY (Duroc × Landrace × Yorkshire) weaned piglets were randomly divided into control, 0.25% and 0.5% leucine groups. The experiment lasted for 42 d. The results showed that dietary supplementation of 0.25% leucine significantly increased the protein expressions

Abstract GH and DGAT1 are candidate genes associated with growth traits in sheep breeds. This study aims to determine the association between growth traits and GH and DGAT1 gene polymorphism using three statistical methods in Awassi sheep. The polymorphism was detected by the PCR-RFLP method. Three genotypes (AA, AB and BB) were observed for GH gene locus with allele and genotype frequency 0.70(A)

Abstract White yak is a unique economic livestock animal on the Qilian Mountains of Qinghai-Tibet Plateau (QTP). Here, 369 mitochondrial D-loop sequences from three Chinese white yak breeds/populations (Tianzhu, Menyuan and Huzhu) were comprehensively analyzed to indicate their maternal genetic diversity, differentiation and phylogenetic relationship. Our results showed that the haplotype diversity

Abstract Bovine viral diarrhea virus (BVDV) is a ubiquitous immunosuppressive etiological agent which is economically important for a wide host range in the livestock industry. Lactobacillus spp. has widely been using in the field of management and treatment of gastro-enteric disease for both humans and animals. The ability of Lacticaseibacillus casei MCJ protein-based metabolized to suppress BVDV

Abstract This research aimed to determine the impact of in ovo resveratrol (RV) (Trans.3, 4, 5-trihydroxystilbene) injection on performance, carcass weights, and blood constituents in Cobb chicks. A total of 300 fertile broiler breeder eggs were divided into five treatments as 60 eggs in each group, with 6 replicates (10 eggs each). The groups were as follows: (1) negative control (without additive)

Abstract Brucellosis is a widely prevalent zoonotic disease of major public health significance. A collection of Brucella melitensis and Brucella abortus field isolates of animal and human origin were subjected to MLVA-15 typing followed by phylogeography studies. The MLVA-15 analysis of B. melitensis (n = 65) field isolates resulted in 48 different profiles. The panel I marker bruce45 was found to

Abstract With the development of miRNAs identification technology, more and more miRNAs have been discovered, and the role of miRNAs in the development of animal hair follicles has become a focus of research on hair-producing animals. In the previous experiment, compare the microRNA (miRNA) trancriptomes of goats and sheep skin using Solexa sequencing and differentially expressed miR-125b was screened

Abstract High ambient temperature has emerged as a major constraint for the future development of the poultry industry, especially in the tropics and subtropics. The scarcity of resources coupled with harsh environmental conditions is the most crucial predicaments in the way to rationalize optimum production of broiler. Heat stress disturbs the physiological biochemistry of the broiler which ultimately

Abstract The rapid healing of impaired intestinal surface plays a role in maintaining intestinal homeostasis. This study investigated the effect of calcium-sensing receptor (CaSR) on the migration and proliferation of intestinal porcine epithelial cells (IPEC-J2). Results showed that cell migration area and width were increased by R568 (CaSR activator) and decreased by NPS2143 (CaSR inhibitor). The

Abstract The present study investigated the anti-inflammatory effects and potential mechanisms of sodium butyrate (SB) in bovine embryo tracheal cells (EBTr) stimulated with lipopolysaccharide (LPS). EBTr were exposed to either 1 mmol/L SB for 18 h for the SB group (SB) or to 0.4 μg/mL LPS for 6 h for the LPS group (LPS). PBS was added to EBTr for a control group (CON). EBTr were pretreated with SB

Abstract A-kinase anchoring protein 13 (AKAP13) is one of the AKAP protein family members, which is correlated with estrogen receptors (ERs) and progesterone receptor (PR) activity. Consequently, the AKAP13 gene is considered to be one of the candidate genes for regulating female fertility. Hence, the objectives of this study were to discover the potential insertion/deletion (indel) variants within

Abstract N6-methyladenosine (m6A) is the most frequent internal modification of mRNA and lncRNA in eukaryotes. We used two high-throughput sequencing method, m6A-seq and RNA-seq to identify pivotal m6A-modified genes in cashmere fineness and fiber growth. 8062 m6A peaks were detected by m6A-seq, including 2157 upregulated and 6445 downregulated. Furthermore, by comparing m6A-modified genes of the male

Abstract This paper presented the results on the study of insulin receptor substrate 1 (IRS1) polymorphisms in Chinese black Tibetan sheep. Via DNA direct sequencing, four variations within 3′ untranslated region (UTR) of IRS1, including g.9382T > G, g.9569T > G, g.9572C > T and g.9695A > C were detected in the black Tibetan sheep population. Based on the χ2 test, those four loci deviated from Hardy–Weinberg

Abstract Our previous study has firstly pointed that three nucleotide variants (g.−11C > T, g.117A > G, and g.149C > T) of the goat PRNT gene can significantly influence litter size. Given litter size is positively correlated with growth performance, we consider whether the PRNT gene also acts on the growth performance in goats. In this work, a correlation analysis among different litter size types

Abstract The objective of this study was to explore the immunological and antioxidant alterations associated with ovine postpartum disorders. Blood samples were collected from 90 adult Barki ewes and allocated into three equal-sized groups (30 ewes each): control group (CG), inflammatory postpartum disorders group (IPG) and non-inflammatory postpartum disorders group (NIPG). PCR-DNA sequencing approach

Abstract Cytidine monophosphate-Nacetylneuraminic acid (Neu5Ac) hydroxylase (CMAH) and glycoprotein, alpha1, 3-galactosyltransferase (GGTA1) double knockout (DKO) pig models were produced to reduce immune reaction for xenotransplantation. However, the role of Neu5Gc and α-Gal in pigs has not been fully elucidated and it is necessary to consider the after-effect of inactivation of GGTA1 and CMAH in

Abstract The purpose of this study was to evaluate the neuroprotective effect of leptin on a non-human primate model of cerebral ischemia. A total of 39 Guangxi macaques were used to establish the primate cerebral-ischemia model. HE staining was used to evaluated the pathological changes. Moreover, magnetic resonance imaging was used for the detection of embolic area. The measurements of behavior observation

Abstract Single nucleotide polymorphisms (SNPs) include the transition and transversion of a single base. In this study, we found two cSNPs (rs110757796 and rs110652478) in the FABP4 (fatty acid-binding protein 4) gene and tested their population genetic parameters in five Chinese cattle breeds. FABP4 is a key marker molecule for lipid production. It plays a crucial role in the growth and development

Abstract PCV2 is the primary etiological agent of porcine circovirus-associated diseases (PCVADs) which affect pigs worldwide. Currently, there is a worldwide genotype prevalence switch from PCV2b to PCV2d, which has led to increased virulence of the circulating virus strains leading to vaccine failures and selection pressure. In the present study, the PCV2 genotypes circulating in north eastern region

Abstract Cow milk might be associated to gastrointestinal disorders and abdominal pain in some people, which are, in part, due to the digestion of A1 beta-casein. Within this context, A2 milk has emerged as an alternative since it only contains A2 beta-casein that does not cause these complications. This milk is produced by cows with the A2A2 genotype. The aim of this study was to investigate the allele

Abstract In the present study, candidate single nucleotide polymorphism (SNP) g.92450765 G > A of leptin gene was explored for Bos indicus cattle with an aim to explore its possible effect on production and reproduction traits. The genotypic and allelic frequencies of BsaA 1 genotyped SNP g.92450765 G > A indicated the predominance of AG (0.65) genotyped Sahiwal cows in our studied population. The

Abstract In this study, the effect of genetic variations of four heat shock transcription factor genes (HSF1, HSF2, HSF4, and HSF5) on the 3 D protein structure and function were studied. We defined the breed-specific genetic variations of pooled DNA of Tali goat that differed from the goat reference sequence (CHI2.0). Disordered regions of HSF proteins were predicted using PONDR. Post-translation

Abstract Whether spermine promotes the repair of porcine intestinal epithelium damage through Ras-related C3 botulinum toxin substrate 1 (Rac1)/phospholipase C-γ1 (PLC-γ1) signaling remains unclear. The current study investigated the effects of spermine addition on the proliferation and migration of IPEC-J2 cells and the effects of Rac1/PLC-γ1 signaling on cell migration. We showed that the inhibitors

Abstract Japanese quail originated from the wildlife environment and was first domesticated in Japan in 1595. Japanese quail has widely distributed in various parts of the world. This bird is characterized by its rapid growth rate, high rate of egg production, much lower space requirements, small size, good reproductive potential, short life cycle, resistance to diseases, early sexual maturity (from

Abstract In this study, novel single nucleotide polymorphisms (SNPs) were found in the 5′-regulatory regions (promoters) of the bovine glucose transporter (GT) genes SLC2A12 and SLC5A1. These polymorphisms were shown to associate with certain milk production traits in HF cows, including milk yield, milk composition, and somatic cell count. It was shown that the SNP g.-671C > G (NC_037336.1: g.72224078C > G)

Abstract An investigation was carried out on Deoni animals of western India to study the allelic and genotypic frequencies in coding region of TYR gene as well as gene expression profile. The animals were grouped according to age, gender, strain and intensity of partial albinism (low, medium and high). The present study revealed that the genotypic frequency of TYR gene across different strains, gender

Abstract Endoplasmic reticulum stress (ERS) plays an important role in regulating the reproductive process of female mammals, mainly involved in follicular atresia and corpus luteum regression. DNA damage induced transcript 3 (DDIT3) is a marker gene of ERS. The objectives of the present study were to clone and analyze the sequence and tissue expression characteristics of DDIT3 gene in female yaks

Abstract Campylobacteriosis is among the most frequently reported foodborne zoonoses. A total of 848 samples were screened for Campylobacter spp. and occurrence was found to be 8.7%, 2.3% and 1.65% in broiler cecum samples, chicken meat samples and slaughter house environment swabs, respectively. High level of antimicrobial resistance was found against tetracycline (64.1%), doxycycline (54.4%), ampicillin

Abstract The present study aimed to investigate the relationship between growth performance, body composition, and fat deposition factors, and feed efficiency in growing lambs. We measured average daily feed intake (ADFI) and body weight (BW) from 653 Hu sheep that were fed a pellet diet. The residual feed intake (RFI) not significantly genetic and phenotypic correlated with the metabolic body weight

Abstract Intramuscular fat is positively related to meat quality including tenderness, flavor, and juiciness. Long noncoding RNA (LncRNA) plays a vital role in regulating adipogenesis. However, it is largely unknown about lncRNAs associated with porcine intramuscular adipocyte adipogenesis. In the present study, we focus on a novel LncRNA, which is named lncIMF2, associated with adipogenesis by our

Abstract For revealing molecular markers related to the traits of multiple lumbar vertebrae in sheep, we analyze the relationship between NR6A1 gene polymorphism and lumbar vertebrae number traits in Xinjiang Kazakh sheep. Lumbar muscle tissues were collected from 6-lumbar spine (L6) Kazak sheep and 7-lumbar spine (L7) Kazak sheep and the intron-8 of NR6A1 gene was amplified by PCR. The SNP locus was

Abstract This paper aims to investigate the influence of increasing chitosan doses on the relative proportion and abundance of cellulotytic, amylolytic bacteria, and Archaea transcripts for grazing cattle. Five rumen cannulated crossbread steers [3.6 months and 300 ± 25 kg body LW (live weight), mean ± standard deviation] were used in a 5 × 5 latin square design, randomly assigned to treatment sequence

Abstract Mammary epithelial cell (MEC) is the basic unit of the mammary gland that synthesizes milk components including milk protein and milk fat. MECs can sense to extracellular stimuli including nutrients such as amino acids though different sensors and signaling pathways. Here, we review recent advances in the regulatory mechanism of amino acids on milk protein and fat synthesis in MECs. We also

Abstract The study planned to estimate biological parameters linked to rheumatoid arthritis (RA) patients, detecting the influence of MTX and biotherapy treatments on these parameters and synthesizing methotrexate bovine serum albumin nanoparticles linked to folate (FA-MTX-BSA NPs) to reduce the overwhelming expression of inflammatory cytokines. Inflammatory parameters showed significant increases

Abstract The corpus luteum (CL) is a temporary organ that plays a critical role for female fertility by maintaining the estrous cycle. MicroRNA (miRNA) is a class of non-coding RNAs involved in various biological processes. However, there exists limited knowledge of the role of miRNA in yak CL. In this study, we used high-throughput sequencing to study the transcriptome dynamics of miRNA in yak early

Abstract Nicobari pig is reared by Nicobarese, a native tribal population of Andaman and Nicobar Islands. Nicobari pig has maintained its genetic identity due to geographical isolation. This communication is the first report on maternal inheritance of Nicobari pigs. DNA polymorphism data showed seven haplotypes. D-loop sequence information and mitogenome analysis were able to earmark Nicobari pigs

Abstract This study compared and analyzed the genetic diversity and population structure of exon 2 of the DQB1 gene and 13 autosomal neutral microsatellite markers from 14 Chinese goat breeds to explore the potential evolutionary mechanism of the major histocompatibility complex (MHC). A total of 287 haplotypes were constructed from MHC-DQB1 exon 2 from 14 populations, and 82 nucleotide polymorphic

Abstract The effect of in ovo feeding of different levels of vitamins C and E on egg hatchability, immune response, growth and carcass traits of broiler chickens were investigated. A total of 672 fertilized eggs were assigned to one of eight experimental groups having three replicates with 28 eggs as follows: (1) negative control (not injected); (2) positive control (injected with 0.2 mL deionized

Abstract Insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1) plays positive roles in the growth, proliferation of cells and early embryos development by binding mRNA targets. Recently, it had been shown that some polymorphic loci within IGF2BP1 gene were associated with growth traits in animals, especially in goats. Therefore, it has been hypothesized that some variants within IGF2BP1 gene

Abstract Skeletal muscle also plays a vital role in regulating the movement energy storage and health of metabolism. In order to investigate the expression profile of protein and phosphor-proteins in chicken skeletal muscle during embryonic development, we performed phosphor-proteomics analysis by label-free and TiO2 enrichment strategy in chicken leg muscle tissues of at embryonic age embryo day 7(E7)

Abstract Copy number variations (CNVs) are major forms of genetic variation with an increasing importance in animal genomics. This study used the Illumina BovineSNP 50 K BeadChip to detect the genome-wide CNVs in the Tharparkar cattle. With the aid of PennCNV software, we noticed a total of 447 copy number variation regions (CNVRs) across the autosomal genome, occupying nearly 2.17% of the bovine genome

Abstract Antibiotic resistance is looming problem in broiler production globally and there has been an increasing interest to look for sustainable alternatives to antibiotics. Yeast and its derived products are recognized as potential feed additives because of their beneficial impacts on poultry. Particularly, yeast exhibited positive effects on the humoral immunity by increasing serum immunoglobulin

Abstract Proteases play a significant role in milk and its products by affecting flavor, texture and longevity. The expression of endogenous proteases varies across different stages of lactation. The study was conducted to understand the transcriptional pattern of different classes of protease-pathways associated genes (CTSB, CTSD, CTSH, CTSL, CTSK, CTSS, CTSZ, PLAU, PLAT) and potential protease inhibitors

Abstract The purpose of this study was to investigate the effects of different protein levels in late pregnancy on ewe and lamb growth performance, serum biochemical indexes. Thirty-three ewes (46.4 ± 1.38 kg initial weight) were randomly divided into 3 groups, with 11 ewes in each group. The protein levels of three diets formulated to provide components to meet 10.00 MJ/kg ME requirements diets were:

Abstract In China, most maize used for animal diets is stored for long periods. We examined the effects of dietary aged maize on growth performance, nutrients utilization, and serum metabolites in broilers. A total of 270 healthy 1-day-old male Cobb broilers were assigned randomly into three treatments groups and fed maize stored for different times (24 days, M0; 18 months, M18; 36 months, M36). Growth

Abstract Early embryo development is driven first by the maternal RNAs and proteins accumulated during the oocyte’s cytoplasmic maturation and then after the embryo genome activation. In mammalian cells, ATP generation occurs via oxidative pathways or by glycolysis, whereas in embryonic stem cells, the consumption of glucose, pyruvate, lipids, and amino acids results in ATP synthesis. Although the

Abstract Mono-Sex culturing is an important methodology for intensive livestock and poultry production. Here, Hintw was identified as a potential key gene in sex-determination process in chickens via RNA-seq. Then we developed an effective method to interfere or overexpress Hintw in chicken embryos through the intravascular injection. QRT-PCR, ELISA and H&E staining were used to detect the effects

Abstract A2 milk is an easily digestible product since it has only A2 beta-casein. In cattle, the A1 and A2 alleles are found in the population and the A2 milk is produced from A2A2 animals. Little is known about these alleles in other domestic dairy species. The present study aims to analyze sequence of genetic material available on public databases and quantify the animals genotyped. Eight domestic

Abstract This study was conducted to examine the influence of uni and bilateral castration on growth performance and lipid metabolism in yellow cattle. Eighteen 9-month-old healthy yellow cattle (average body weight 184.03 ± 4.09 kg) were selected and divided into three groups: The uncastrated cattle (C), half castrated cattle (HC) and full castrated cattle (FC). The results showed that the growth

Abstract Sixty-four male New Zealand White rabbits, 4 weeks old, were used to study the effects of feed restriction (FR) on growth performance, carcass traits, and some blood parameters. Rabbits were randomly allotted to 4 equal groups. The first group was fed ad libitum (control group). The second, third, and fourth groups were restricted from 4 to 8 (R4–8), 8 to 12 (R8–12), and 4 to 12 (R4–12) weeks

(2021). Correction. Animal Biotechnology. Ahead of Print.

Abstract Bos indicus breed Sahiwal, famous for its optimum performance, has so far been genetically improved for performance traits based on phenotypic records and the genomic knowhow regarding genes, regions and biological processes underlying the complex quantitative traits is lacking. In this context, a Genome-wide Association Study was performed for fertility and growth traits in Sahiwal cattle