当前期刊: BMC Medical Genetics Go to current issue    加入关注   
显示样式:        排序: 导出
我的关注
我的收藏
您暂时未登录!
登录
  • Familial autosomal recessive bestrophinopathy: identification of a novel variant in BEST1 gene and the specific metabolomic profile
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-22
    Panpan Ye; Jia Xu; Yueqiu Luo; Zhitao Su; Ke Yao

    Autosomal recessive bestrophinopathy (ARB) is a retinal degenerative disorder caused by BEST1 mutations with autosomal recessive inheritance. We aim to map a comprehensive genomic and metabolomic profile of a consanguineous Chinese family with ARB. Ophthalmic examinations were performed on the affected patients with ARB. The proband was screened for potential causative mutations in a panel with 256 known retinal disease genes by using target capture sequencing. The related mutation was further validated and segregated in the family members by Sanger sequencing. In silico prediction tools were used for pathogenicity assessment. A UHPLC-MS/MS metabolomic analysis was performed to explore the disease-associated metabolic feature. The affected patients from this family were characterized by low vision, the presence of subretinal fluid, macular edema, and hyperopia with coincidental angle closure. DNA sequencing identified a novel missense mutation in the BEST1 gene c.646G > A (p.Val216Ile) of the proband. Sanger sequencing further confirmed the mutation. The missense mutation was co-segregation across the pedigree and predicted to be deleterious by SIFT (0.017). The blood metabolic profiles were highly similar among all family members probably because of the same lifestyle, habitat and genomic background. However, ARB patients presented a significant deregulation of metabolites, such as citric acid, L-Threonic acid, and eicosapentaenoic acid. We identified a novel disease-associated variant in the BEST1 gene as well as a disease-specific metabolic feature in familial ARB. Our findings helped improve the understanding of ARB mechanisms.

    更新日期:2020-01-23
  • A case report of Proteus syndrome (PS)
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-21
    Xiaoyun Zeng; Xiaoming Wen; Xinxin Liang; Lina Wang; Lingling Xu

    Proteus syndrome (PS) is an extremely rare disease characterized by excessive chimeric growth of cells, and progressive and irregular asymmetrical hyperplasia. Herein, a PS case with atypical clinical features and syndromes was reported, to improve the understanding of the diagnosis and treatment of the disease. The case was a 3-year-and-11-month-old male child. He was admitted due to a primary diagnosis of McCune-Albright syndrome. After admission, the lesion samples from the milk coffee spots, and nodular thickening skin at hands and feet were subjected to genetic screening. Genetic testing results confirmed the diagnosis of PS. Based on the clinical manifestations, laboratory tests, imaging data, and literature reviewing, the etiology, diagnosis, treatment and prognosis of PS have been analyzed and discussed.

    更新日期:2020-01-22
  • Association analysis between the tag single nucleotide polymorphisms of DENND1A and the risk of polycystic ovary syndrome in Chinese Han women
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-15
    Ya-nan Zhu; Yi-ting Zhang; Qin Liu; Shan-mei Shen; Xiang Zou; Yun-xia Cao; Wen-jun Wang; Long Yi; Qian Gao; Wei-dong Yang; Yong Wang

    The DENND1A gene is one of the most important sites associated with polycystic ovary syndrome (PCOS). We attempted to analyze the correlation between five single nucleotide polymorphisms (SNPs) in the DENND1A gene and the development of PCOS. A total of 346 PCOS patients and 225 normal ovulatory women were involved in the case-control study. Clinical variables and hormones were recorded. According to the Hap Map database, five tagging SNPs (rs2479106, rs2768819, rs2670139, rs2536951 and rs2479102) in the DENND1A gene were identified. The TaqMan probe and the PCR–RFLP (restriction fragment length polymorphism) methods were used for revealing these genotypes. TaqMan Genotype Software was used to analyze the alleles of the five SNPs. Linkage disequilibrium and the gene frequency analysis demonstrated that the CCGGG haplotype might increase the risk of PCOS (P = 0.038, OR = 1.89, 95% CI = 1.027–3.481). Significant differences were found in genotypic and allelic distributions at the rs2536951 and rs2479102 loci between PCOS women and controls (P < 0.001). The LH levels and LH/FSH ratios were higher in PCOS patients than in the control group. A detailed analysis revealed that for the rs2479106 locus, these two values were significantly different in the control subjects who had AA, AG and GG genotypes (P = 0.013 and P = 0.007, respectively), and for the rs2468819 locus, these two values were significantly different among the PCOS patients with AA, AG and GG genotypes (P = 0.013 and 0.002, respectively). The tagging SNPs rs2479106 and rs2468819 in the DENND1A gene are associated with PCOS in the Chinese population, whereas rs2670139, rs2536951 and rs2479102 are not correlated with PCOS in the same population.

    更新日期:2020-01-15
  • Clinical and genetic analysis of two wolfram syndrome families with high occurrence of wolfram syndrome and diabetes type II: a case report
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-14
    Maryam Sobhani; Mohammad Amin Tabatabaiefar; Soudeh Ghafouri-Fard; Asadollah Rajab; Asal Hojat; Abdol-Mohammad Kajbafzadeh; Mohammad Reza Noori-Daloii

    Mutations of the WFS1 gene are responsible for most cases of Wolfram syndrome (WS), a rare, recessively inherited neurodegenerative disorder characterized by juvenile-onset non-autoimmune diabetes mellitus and optic atrophy. Variants of WFS1 are also associated with non-syndromic hearing loss and type-2 diabetes mellitus (T2DM). Our study adds to literature significant associations between WS and T2DM. In this study, we analyzed the clinical and genetic data of two families with high prevalence of WS and T2DM. Genetic linkage analysis and DNA sequencing were exploited to identify pathogenic variants. One novel pathogenic variant (c.2243-2244insC) and one known pathogenic (c.1232_1233delCT) (frameshift) variant were identified in exon eight of WFS1 gene. The mutational and phenotypic spectrum of WS is broadened by our report of novel WFS1 mutation. Our results reveal the value of molecular analysis of WFS1 in the improvement of clinical diagnostics for WS. This study also confirms the role of WFS1 in T2DM.

    更新日期:2020-01-15
  • Assessment of cellular cobalamin metabolism in Gaucher disease
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-13
    Suelen Porto Basgalupp; Marina Siebert; Charles Ferreira; Sidney Behringer; Ute Spiekerkoetter; Luciana Hannibal; Ida Vanessa Doederlein Schwartz

    Gaucher disease (GD) is a lysosomal disorder caused by biallelic pathogenic mutations in the GBA1 gene that encodes beta-glucosidase (GCase), and more rarely, by a deficiency in the GCase activator, saposin C. Clinically, GD manifests with heterogeneous multiorgan involvement mainly affecting hematological, hepatic and neurological axes. This disorder is divided into three types, based on the absence (type I) or presence and severity (types II and III) of involvement of the central nervous system. At the cellular level, deficiency of GBA1 disturbs lysosomal storage with buildup of glucocerebroside. The consequences of disturbed lysosomal metabolism on biochemical pathways that require lysosomal processing are unknown. Abnormal systemic markers of cobalamin (Cbl, B12) metabolism have been reported in patients with GD, suggesting impairments in lysosomal handling of Cbl or in its downstream utilization events. Cultured skin fibroblasts from control humans (n = 3), from patients with GD types I (n = 1), II (n = 1) and III (n = 1) and an asymptomatic carrier of GD were examined for their GCase enzymatic activity and lysosomal compartment intactness. Control human and GD fibroblasts were cultured in growth medium with and without 500 nM hydroxocobalamin supplementation. Cellular cobalamin status was examined via determination of metabolomic markers in cell lysate (intracellular) and conditioned culture medium (extracellular). The presence of transcobalamin (TC) in whole cell lysates was examined by Western blot. Cultured skin fibroblasts from GD patients exhibited reduced GCase activity compared to healthy individuals and an asymptomatic carrier of GD, demonstrating a preserved disease phenotype in this cell type. The concentrations of total homocysteine (tHcy), methylmalonic acid (MMA), cysteine (Cys) and methionine (Met) in GD cells were comparable to control levels, except in one patient with GD III. The response of these metabolomic markers to supplementation with hydroxocobalamin (HOCbl) yielded variable results. The content of transcobalamin in whole cell lysates was comparable in control human and GD patients. Our results indicate that cobalamin transport and cellular processing pathways are overall protected from lysosomal storage damage in GD fibroblasts. Extending these studies to hepatocytes, macrophages and plasma will shed light on cell- and compartment-specific vitamin B12 metabolism in Gaucher disease.

    更新日期:2020-01-14
  • MicroRNA-19b-3p promotes cell proliferation and osteogenic differentiation of BMSCs by interacting with lncRNA H19
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-09
    Gan Xiaoling; Liu Shuaibin; Liang Kailu

    To investigated the role of miR-19b-3p in regulating bone marrow mesenchymal stem cell (BMSC) proliferation and osteoblast differentiation. The expression of miR-19b-3p and lncRNA H19 were measured in postmenopausal osteoporosis patients and BMP-22 induced BMSCs using qRT-PCR. MiR-19b-3p mimic or inhibitor was transfected into BMP-2 induced BMSCs. Cell proliferation was measured by BrdU method. Protein expression of RUNX2 and COL1A1 were measured by western blot. PcDNA3.1-lncRNA H19 with or without miR-19b-3p mimic was transfected into BMP-2 induced BMSCs. The expression of miR-19b-3p was significantly up-regulated in postmenopausal osteoporosis patients and BMP-2 induced BMSCs. MiR-19b-3p overexpression dramatically elevated, while miR-19b-3p inhibition decreased cell proliferation of BMSCs. Additionally, protein expression levels of RUNX2 and COL1A1, as well as ALP activity were significantly promoted by miR-19b-3p mimic transfection and inhibited by miR-19b-3p inhibitor transfection. LncRNA H19 was obviously down-regulated in postmenopausal osteoporosis patients. H19 overexpression significantly decreased cell proliferation and differentiation by down-regulating miR-19b-3p. Moreover, the expression of miR-19b-3p was inhibited, while H19 elvated in 17β-estradiol (E2) treated BMSCs in a dose-dependent manner. These data were the first to reveal the critical role of H19/miR-19b-3p in postmenopausal osteoporosis, and provided a new therapeutic target for OP.

    更新日期:2020-01-11
  • Chromatin remodeling dysfunction extends the etiological spectrum of schizophrenia: a case report
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-08
    Alice Poisson; Nicolas Chatron; Audrey Labalme; Pierre Fourneret; Dorothée Ville; Marie Laure Mathieu; Damien Sanlaville; Caroline Demily; Gaëtan Lesca

    The role of deleterious copy number variations in schizophrenia is well established while data regarding pathogenic variations remain scarce. We report for the first time a case of schizophrenia in a child with a pathogenic mutation of the chromodomain helicase DNA binding protein 2 (CHD2) gene. The proband was the second child of unrelated parents. Anxiety and sleep disorders appeared at the age of 10 months. He presented febrile seizures and, at the age of 8, two generalized tonic-clonic seizures. At the age of 10, emotional withdrawal emerged, along with a flat affect, disorganization and paranoid ideation, without seizures. He began to talk and giggle with self. Eventually, the patient presented daily auditory and visual hallucinations. The diagnosis of childhood onset schizophrenia (DSM V) was then evoked. Brain imaging was unremarkable. Wakefulness electroencephalography showed a normal background and some bilateral spike-wave discharges that did not explain the psychosis features. A comparative genomic hybridization array (180 K, Agilent, Santa Clara, CA, USA) revealed an 867-kb 16p13.3 duplication, interpreted as a variant of unknown significance confirmed by a quantitative PCR that also showed its maternal inheritance. Risperidone (1,5 mg per day), led to clinical improvement. At the age of 11, an explosive relapse of epilepsy occurred with daily seizures of various types. The sequencing of a panel for monogenic epileptic disorders and Sanger sequencing revealed a de novo pathogenic heterozygous transition in CHD2 (NM_001271.3: c.4003G > T). This case underlines that schizophrenia may be, sometimes, underpinned by a Mendelian disease. It addresses the question of systematic genetic investigations in the presence of warning signs such as a childhood onset of the schizophrenia or a resistant epilepsy. It points that, in the absence of pathogenic copy number variation, the investigations should also include a search for pathogenic variations, which means that some of the patients with schizophrenia should benefit from Next Generation Sequencing tools. Last but not least, CHD2 encodes a member of the chromodomain helicase DNA-binding (CHD) family involved in chromatin remodeling. This observation adds schizophrenia to the phenotypic spectrum of chromodomain remodeling disorders, which may lead to innovative therapeutic approaches.

    更新日期:2020-01-09
  • Angiotensin-converting enzyme gene insertion/deletion polymorphism and susceptibility to psoriasis: a systematic review and meta-analysis
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-08
    Mazaher Ramezani; Elisa Zavattaro; Masoud Sadeghi

    Psoriasis is a multifactorial disorder, impacted by both genetic and environmental factors. Herein, a meta-analysis assessed the association of angiotensin-converting enzyme gene insertion/deletion (ACE I/D) polymorphism and psoriasis susceptibility. A systematic search was used in databases of PubMed/Medline, Scopus, Web of Science, and Cochrane Library up to January 2019 without language restriction. A dichotomous analysis was carried out by RevMan 5.3 using crude odds ratio (OR) and 95% confidence interval (CI) to investigate the association between ACE I/D polymorphisms and the risk of psoriasis. A funnel plot analysis was used by CMA 2.0 to estimate a significant existence of publication bias. Out of 61 studies retrieved from the databases, 16 studies were included in the meta-analysis. The pooled ORs for models of D vs. I, DD vs. II, ID vs. II, ID + DD vs. II, and DD vs. II + ID genotypes were 0.96 [95%CI: 0.82, 1.12; P = 0.58], 0.99 [95%CI, 0.73, 1.36; P = 0.96], 0.81 [95%CI, 0.72, 0.91; p: 0.0003], 0.91 [95%CI, 0.73, 1.13; P = 0.40], and 1.05 [95%CI, 0.85, 1.30; P = 0.68], respectively. A significant difference between ACE polymorphisms in patients with/without family history for the disease [OR = 1.44; 95%CI: 1.24, 1.67; P < 0.001] and also in patients mild/severe psoriasis [OR = 0.70; 95%CI: 0.55, 0.88; P = 0.002] was identified. The results of the meta-analysis showed that ACE I/D polymorphism may be associated with psoriasis susceptibility, while ID genotype seemed to have a protective role in Caucasian patients affected by psoriatic arthritis and in studies with hospital-based controls.

    更新日期:2020-01-08
  • Novel deep intronic mutation in the coagulation factor XIII a chain gene leading to unexpected RNA splicing in a patient with factor XIII deficiency
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-08
    Jun Deng; Dan Li; Heng Mei; Liang Tang; Hua-fang Wang; Yu Hu

    Coagulation factor XIII (FXIII) plays an essential role in maintaining hemostasis by crosslinking fibrin. Deficiency in FXIII affects clot stability and increases the risk of severe bleeding. Congenital FXIII deficiency is a rare disease. Recently, we identified a Chinese family with FXIII deficiency and investigated the pathogenesis of congenital FXIII deficiency, contributing non-coding pathogenic variants. We performed common tests, coding sequencing by targeted next-generation sequencing (NGS), whole-genome sequencing and splice-sites prediction algorithms. The pathogenesis was investigated via minigene and nonsense-mediated mRNA decay (NMD) by experiments in vitro. The proband is homozygote for a novel deep intronic c.799-12G > A mutation in the F13A1 gene. Through direct sequencing of the minigenes mRNA, we found 10 bases of intron 6 insert in the mRNA of mutant minigenes mRNA. The relative expression of EGFP-F13A1 was higher by suppression of NMD in vitro. Furthermore, we found the proband with enhanced thrombin generation (TG). We reported a novel deep intronic c.799-12G > A mutation of F13A1 which produced a new acceptor site and frame shifting during translation introducing a premature termination codon. Our results support the premature termination codon triggered NMD. We need to pay attention to the position of potential alterable splicing sites while counselling and genetic test. The finding of enhanced TG indicated that we should be aware of the risk of thrombosis in patients with FXIII deficiency during replacement therapy.

    更新日期:2020-01-08
  • Case report: targeted whole exome sequencing enables the first prenatal diagnosis of the lethal skeletal dysplasia Osteocraniostenosis
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-07
    Lara Pemberton; Robert Barker; Anna Cockell; Vijaya Ramachandran; Andrea Haworth; Tessa Homfray

    Osteocraniostenosis (OCS) is a rare genetic disorder characterised by premature closure of cranial sutures, gracile bones and perinatal lethality. Previously, diagnosis has only been possible postnatally on clinical and radiological features. This study describes the first prenatal diagnosis of OCS. In this case prenatal ultrasound images were suggestive of a serious but non-lethal skeletal dysplasia. Due to the uncertain prognosis the parents were offered Whole Exome Sequencing (WES), which identified a specific gene mutation in the FAMIIIa gene. This mutation had previously been detected in two cases and was lethal in both perinatally. This established the diagnosis, a clear prognosis and allowed informed parental choice regarding ongoing pregnancy management. This case report supports the use of targeted WES prenatally to confirm the underlying cause and prognosis of sonographically suspected abnormalities.

    更新日期:2020-01-07
  • Identification of a compound heterozygote in LYST gene: a case report on Chediak-Higashi syndrome
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-06
    Yinsen Song; Zhengping Dong; Shuying Luo; Junmei Yang; Yuebing Lu; Bo Gao; Tianli Fan

    Chediak-Higashi Syndrome (CHS) is a rare autosomal recessive disease caused by loss of function of the lysosomal trafficking regulator protein. The causative gene LYST/CHS1 was cloned and identified in 1996, which showed significant homology to other species such as bovine and mouse. To date, 74 pathogenic or likely pathogenic mutations had been reported. Here we describe a compound heterozygote in LYST gene, which was identified in a 4-year-old female patient. The patient showed skin hypopigmentation, sensitivity to light, mild splenomegaly and reduction of platelets in clinical examination. Giant intracytoplasmic inclusions were observed in the bone marrow examination, suggesting the diagnosis of CHS. Amplicon sequencing was performed to detect pathogenic mutation in LYST gene. The result was confirmed by two-generation pedigree analysis base on sanger sequencing. A compound heterozygote in LYST gene, consisting of a missense mutation c.5719A > G and an intron mutation c.4863-4G > A, was identified from the patient by using amplicon sequencing. The missense mutation is reported for the first time. Two-generation pedigree analysis showed these two mutations were inherited from the patient’s parents, respectively. Our result demonstrated that amplicon sequencing has great potential for accelerating and improving the diagnosis of rare genetic diseases.

    更新日期:2020-01-06
  • Association between serotonin 2A receptor (HTR2A) genetic variations and risk of hypertension in a community-based cohort study
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-06
    Jung Ran Choi; Minhee Jeon; Sang Baek Koh

    Hypertension is one of the risk factors for obesity-related cardiovascular diseases. We investigated whether genetic variations in serotonin 2A receptor (HTR2A) were associated with hypertension. We carried out a cross-sectional study in cohorts A (Ansan-Ansung cohort, N = 6039) and B (Wonju-Pyengchang cohort, N = 7524). Several genetic variants in HTR2A including rs7330636, rs9590999, rs2183057, and rs4942595 were selected and genotyped. In hypertensive participants in cohort A, the baseline systolic blood pressure and body mass index were 141.80 ± 17.20 mg/dL and 24.48 ± 4.75 kg/m2, respectively, which were higher than in those without hypertension (p < 0.001). rs4942595TC genotype was associated with hypertension in cohort A (OR = 0.739), after adjusting for variables. Subjects with rs4942578AA genotype had a decreased risk of hypertension after adjusting for clinical factor (OR = 0.735) in cohort B, and an elevated risk of hypertension in cohort A (OR = 1.562). The logistic regression analysis showed that participants with rs4941573TC genotype were 1.327 times more likely to have a higher blood pressure than those with TT genotype (95% CI 1.101–1.599) in cohort B. Whereas, the OR for developing hypertension in subjects with rs17069883CC genotype compared to those with AA genotype was 1.447 (95% CI 1.018–2.056; p for trend = 0.040) in cohort A. HTR2A genetic variations were associated with hypertension risk in our study.

    更新日期:2020-01-06
  • Alpha and beta-Thalassemia mutations in Hubei area of China
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-06
    Yaowu Zhu; Na Shen; Xiong Wang; Juan Xiao; Yanjun Lu

    Thalassemia is a group of inherited hemoglobic disorders resulting from defects in the synthesis of one or more of the hemoglobin chains, which is one of the most prevalent inherited disorders in southern China. Only few studies reported the molecular characterization of α- and β-Thalassemia in Hubei Province in the central of China. A total of 4889 clinically suspected cases of thalassemia were analyzed by Gap-PCR, PCR-based reverse dot blot (RDB). 1706 (33.8%) subjects harbored thalassemia mutations, including 539 (11.0%) subjects with α-thalassemia, 1140 (23.3%) subjects with β-thalassemia mutations, and 25 (0.51%) subjects with both α- and β-thalassemia mutations. Seven genotypes of α-thalassemia mutations and 29 genotypes of β-thalassemia mutations were characterized. --SEA/αα (66.05%), −α3.7/αα (24.12%), and -α4.2/αα (3.71%) accounted for 93.88% of the α-thalassemia mutations. βIVS-II-654/βN, βCD41–42/βN, βCD17/βN, βCD27–28/βN, βCD71–72/βN, β − 28/βN, β − 29/βN, βCD43/βN, βE/βN, accounting for 96.40% of all β-thalassemia genotypes. Furthermore, mean corpuscular volume (MCV) and mean corpuscular Hb (MCH) were sensitive markers for both β-thalassemia and α-thalassemia with --SEA/αα, but not -α3.7/αα and -α4.2/αα. Conclusions: Our data indicated great heterogeneity and extensive spectrum of thalassemias in Hubei province of China.

    更新日期:2020-01-06
  • lncRNA TINCR sponges miR-214-5p to upregulate ROCK1 in hepatocellular carcinoma
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-03
    Min Hu; Yaowu Han; Ying Zhang; Yuanfeng Zhou; Lin Ye

    Our preliminary bioinformatics analysis showed that lncRNA TINCR may absorb miR-214-5p by serving is sponge, while miR-214-5p targets ROCK1. This study aimed to investigate the interactions among these 3 factors in hepatocellular carcinoma (HCC). Expression of TINCR, ROCK1 and miR-214-5p in HCC and non-tumor tissues was detected by performing qPCR. The correlations among TINCR, ROCK1 and miR-214-5p in HCC tissues were analyzed by performing linear regression. Overexpression experiments were performed to analyze gene interactions. Cell proliferation was analyzed by CCK-8 assay. We found that TINCR and ROCK1 were upregulated, while miR-214-5p was downregulated in HCC. TINCR and ROCK1 were positively correlated, while TINCR and miR-214-5p were not significantly correlated. In HCC cells, TINCR overexpression is followed by ROCK1 overexpression, while miR-214-5p overexpression induced the downregulation of ROCK1. In addition, TINCR and miR-214-5p did not affect the expression of each other. TINCR and ROCK1 overexpression led to increased rate of cancer cell proliferation, while miR-214-5p played an opposite role and reduced the effects of TINCR overexpression. Therefore, TINCR sponges miR-214-5p to upregulate ROCK1 in HCC, thereby promoting cancer cell invasion and migration.

    更新日期:2020-01-04
  • Rapid response of stage IV colorectal cancer with APC/TP53/KRAS mutations to FOLFIRI and Bevacizumab combination chemotherapy: a case report of use of liquid biopsy
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-03
    Alexander Hendricks; Philip Rosenstiel; Sebastian Hinz; Greta Burmeister; Christoph Röcken; Kathrin Boersch; Clemens Schafmayer; Thomas Becker; Andre Franke; Michael Forster

    Liquid biopsies of blood plasma cell free DNA can be used to monitor treatment response and potentially detect mutations that are present in resistant clones in metastatic cancer patients. In our non-interventional liquid biopsy study, a male patient in his fifties diagnosed with stage IV colorectal cancer and polytope liver metastases rapidly progressed after completing chemotherapy and deceased 8 months after diagnosis. Retrospective cell free DNA testing showed that the APC/TP53/KRAS major clone responded quickly after 3 cycles of FOLFIRI + Bevacizumab. Retrospective exome sequencing of pre-chemotherapy and post-chemotherapy tissue samples including metastases confirmed that the APC/TP53/KRAS and other major clonal mutations (GPR50, SLC5A, ZIC3, SF3A1 and others) were present in all samples. After the last chemotherapy cycle, CT imaging, CEA and CA19–9 markers validated the cfDNA findings of treatment response. However, 5 weeks later, the tumour had rapidly progressed. As FOLFIRI+Bevacizumab has recently also been associated with sustained complete remission in a APC/TP53/KRAS triple-mutated patient, these driver genes should be tested and monitored in a more in-depth manner in future patients. Patients with metastatic disease should be monitored more closely during and after chemotherapy, ideally using cfDNA.

    更新日期:2020-01-04
  • Post-lingual non-syndromic hearing loss phenotype: a polygenic case with 2 biallelic mutations in MYO15A and MITF
    BMC Med. Genet. (IF 1.74) Pub Date : 2020-01-02
    Athar Khalil; Samer Bou Karroum; Rana Barake; Gabriel Dunya; Samer Abou-Rizk; Amina Kamar; Georges Nemer; Marc Bassim

    Hearing loss (HL) represents the most common congenital sensory impairment with an incidence of 1–5 per 1000 live births. Non-syndromic hearing loss (NSHL) is an isolated finding that is not part of any other disorder accounting for 70% of all genetic hearing loss cases. In the current study, we reported a polygenic mode of inheritance in an NSHL consanguineous family using exome sequencing technology and we evaluated the possible effect of the detected single nucleotide variants (SNVs) using in silico methods. Two bi-allelic SNVs were detected in the affected patients; a MYO15A (. p.V485A) variant, and a novel MITF (p.P338L) variant. Along with these homozygous mutations, we detected two heterozygous variants in well described hearing loss genes (MYO7A and MYH14). The novel MITF p. Pro338Leu missense mutation was predicted to change the protein structure and function. A novel MITF mutation along with a previously described MYO15A mutation segregate with an autosomal recessive non-syndromic HL case with a post-lingual onset. The findings highlight the importance of carrying whole exome sequencing for a comprehensive assessment of HL genetic heterogeneity.

    更新日期:2020-01-02
  • Genomic analysis of a spinal muscular atrophy (SMA) discordant family identifies a novel mutation in TLL2, an activator of growth differentiation factor 8 (myostatin): a case report
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-30
    Jianping Jiang; Jinwei Huang; Jianlei Gu; Xiaoshu Cai; Hongyu Zhao; Hui Lu

    Spinal muscular atrophy (SMA) is a rare neuromuscular disorder threating hundreds of thousands of lives worldwide. And the severity of SMA differs among different clinical types, which has been demonstrated to be modified by factors like SMN2, SERF1, NAIP, GTF2H2 and PLS3. However, the severities of many SMA cases, especially the cases within a family, often failed to be explained by these modifiers. Therefore, other modifiers are still waiting to be explored. In this study, we presented a rare case of SMA discordant family with a mild SMA male patient and a severe SMA female patient. The two SMA cases fulfilled the diagnostic criteria defined by the International SMA Consortium. With whole exome sequencing, we confirmed the heterozygous deletion of exon7 at SMN1 on the parents’ genomes and the homozygous deletions on the two patients’ genomes. The MLPA results confirmed the deletions and indicated that all the family members carry two copies of SMN2, SERF1, NAIP and GTF2H2. Further genomic analysis identified compound heterozygous mutations at TLL2 on the male patient’s genome, and compound heterozygous mutations at VPS13A and the de novo mutation at AGAP5 on female patient’s genome. TLL2 is an activator of myostatin, which negatively regulates the growth of skeletal muscle tissue. Mutation in TLL2 has been proved to increase muscular function in mice model. VPS13A encodes proteins that control the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. And AGAP5 was reported to have GTPase activator activity. We reported a case of SMA discordant family and identified mutations at TLL2, VPS13A and AGAP5 on the patients’ genomes. The mutations at TLL2 were predicted to be pathogenic and are likely to alleviate the severity of the male SMA patient. Our finding broadens the spectrum of genetic modifiers of SMA and will contribute to accurate counseling of SMA affected patients and families.

    更新日期:2019-12-31
  • A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-23
    Tahir Zaib; Wei Ji; Komal Saleem; Guangchen Nie; Chao Li; Lin Cao; Baijun Xu; Kexian Dong; Hanfei Yu; Xuguang Hao; Yan Xue; Shuhan Si; Xueyuan Jia; Jie Wu; Xuelong Zhang; Rongwei Guan; Guohua Ji; Jing Bai; Feng Chen; Yong Liu; Wenjing Sun; Songbin Fu

    Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

    更新日期:2019-12-23
  • POLE mutations improve the prognosis of endometrial cancer via regulating cellular metabolism through AMF/AMFR signal transduction
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-21
    Yiran Li; Yiding Bian; Kai Wang; Xiao-Ping Wan

    The morbidity and mortality of endometrial tumors, a common type of malignant cancer in women, have increased in recent years. POLE encodes the DNA polymerase ε, which is responsible for the leading strand DNA replication. Somatic mutations of POLE have been acknowledged in numerous cancers, resulting in the accumulation of DNA errors, leading to ultra-mutated tumors. Mutations in the exonuclease domain of POLE have been reported to improve progression-free survival in endometrial cancer. However, the potential relationship and underlying mechanism between POLE mutations and the prognosis of endometrial cancer patients remains unclear. The whole exome sequencing data, RNA sequencing data, and clinical information were obtained from the TCGA database and employed for the analyses in this study. The detailed mutational information was analyzed using whole exome sequencing data and the mutated genes were shown with OncoPlot. The survival curves and cox proportional hazards regression analysis were used to accessed patient prognosis, the association of clinical characteristics and prognosis. Differentially expressed genes were analyzed by the edgeR R/Bioconductor package, then the GSEA Pre-ranked tool was used for Gene Set Enrichment Analysis (GSEA) to estimate the function of genes. Expression values were clustered using hierarchical clustering with Euclidean distance and ward linkage by the dendextend R package. POLE mutational status was proven to be an independent prognostic factor for endometrial cancer patients. Patients with somatic POLE mutations presented a favorable prognosis. POLE mutations regulated glycolysis and cytokine secretion, affecting cell metabolism and immune response. Autocrine motility factor (AMF)/PGI and AMFR/gp78 exhibited higher expression levels in POLE mutant patients. The comprehensive high expressions of AMFR/gp78 and low expression of POLE were associated with the favorable prognosis of endometrial cancer patients. This study showed the POLE mutations a vital factor in endometrial cancer patients, leading to a higher expression of AMF/PGI and AMFR/gp78. These results suggested comprehensive consideration of the POLE mutations, expression of AMF/PGI and AMFR/gp78 may provide a more feasible and effective approach for the treatment of endometrial cancer, which might improve the prognosis.

    更新日期:2019-12-22
  • Vitamin D receptor ApaI polymorphism associated with progression of liver disease in Vietnamese patients chronically infected with hepatitis B virus
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-21
    Nghiem Xuan Hoan; Nguyen Khuyen; Dao Phuong Giang; Mai Thanh Binh; Nguyen Linh Toan; Do Tuan Anh; Ngo Tat Trung; Mai Hong Bang; Christian G. Meyer; Thirumalaisamy P. Velavan; Le Huu Song

    Vitamin D derivatives and their receptor (VDR) are potent modulators of immune responses in various diseases including malignancies as well as in metabolic and infectious disorders. The impact of vitamin D receptor polymorphisms on clinical outcomes of hepatitis B virus (HBV) infection is not well understood. This study aims to investigate the potential role of VDR polymorphisms (TaqI, FokI, ApaI, and BsmI) in Vietnamese HBV infected patients and to correlate these polymorphisms with the progression of HBV-related liver disease. Four hundred forty-three HBV infected patients of the three clinically well-defined subgroups chronic hepatitis B (CHB, n = 183), liver cirrhosis (LC, n = 89) and hepatocellular carcinoma (HCC, n = 171) and 238 healthy individuals (HC) were enrolled. VDR polymorphisms were genotyped by DNA sequencing and in-house validated ARMS assays. Logistic regression models were applied in order to determine the association of VDR polymorphisms with manifest HBV infection as well as with progression of related liver diseases mulin different genetic models. The VDR ApaI CA genotype was less frequent in HCC than in CHB patients in different genetic models (codominant model, OR = 0.5, 95%CI = 0.3–0.84, P = 0.004; dominant model, OR = 0.46, 95%CI = 0.27–0.76, P = 0.0023). In the recessive model, the genotype ApaI AA was found more frequently among HCC compared to CHB patients (OR = 2.56, 95%CI = 1.01–6.48, P = 0.04). Similarly, the ApaI CA genotype was less frequent in HCC than in non-HCC group codominant model, OR = 0.6, 95%CI = 0.4–0.98, dominant model, P = 0.04 and OR = 0.6, 95%CI = 0.38–0.90, P = 0.017). The ApaI genotypes CA and AA was significantly associated with higher levels of liver enzymes, bilirubin, and HBV DNA (P < 0.05). No association between TaqI, FokI and BsmI polymorphisms and any clinical outcome as well as liver disease progression was found. Among the four investigated VDR polymorphisms, ApaI is associated with clinical outcome and liver disease progression in Vietnamese HBV infected patients.

    更新日期:2019-12-21
  • Identification of two novel COL10A1 heterozygous mutations in two Chinese pedigrees with Schmid-type metaphyseal chondrodysplasia
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-19
    Lingchi Kong; Li Shi; Wenbo Wang; Rongtai Zuo; Mengwei Wang; Qinglin Kang

    Schmid-type metaphyseal chondrodysplasia (MCDS) is an autosomal dominant disorder caused by COL10A1 mutations, which is characterized by short stature, waddling gait, coxa vara and bowing of the long bones. However, descriptions of the expressivity of MCDS are rare. Two probands and available family members affected with MCDS were subjected to clinical and radiological examination. Genomic DNA of all affected individuals was subjected to whole-exome sequencing, and candidate mutations were verified by Sanger sequencing in all available family members and in 250 healthy donors. A spatial model of the type X collagen (α1) C-terminal noncollagenous (NC1) domain was further constructed. We found that the phenotype of affected family members exhibited incomplete dominance. Mutation analysis indicated that there were two novel heterozygous missense mutations, [c.1765 T > A (p.Phe589Ile)] and [c.1846A > G (p.Lys616Glu)] in the COL10A1 gene in family 1 and 2, respectively. The two novel substitution sites were highly conserved and the mutations were predicted to be deleterious by in silico analysis. Furthermore, protein modeling revealed that the two substitutions were located in the NC1 domain of collagen X (α1), which potentially impacted the trimerization of collagen X (α1) and combination with molecules in the pericellular matrix. Two novel mutations were identified in the present study, which will facilitate diagnosis of MCDS and further expand the spectrum of the COL10A1 mutations associated with MCDS patients. In addition, our research revealed the phenomenon of incomplete dominance in MCDS.

    更新日期:2019-12-20
  • Broadening the phenotype of the TWNK gene associated Perrault syndrome
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-18
    Bálint Fekete; Klára Pentelényi; Gabor Rudas; Anikó Gál; Zoltán Grosz; Anett Illés; Jimoh Idris; Gabor Csukly; Andor Domonkos; Maria Judit Molnar

    Perrault syndrome is a genetically heterogenous, very rare disease, characterized clinically by sensorineural hearing loss, ovarian dysfunction and neurological symptoms. We present the case of a 33 years old female patient with TWNK-associated Perrault syndrome. The TWNK gene is coding the mitochondrial protein Twinkle and currently there are only two reports characterizing the phenotype of TWNK-associated Perrault syndrome. None of these publications reported about special brain MRI alterations and neuropathological changes in the muscle and peripheral nerves. Our patients with TWNK-dependent Perrault syndrome had severe bilateral hypoacusis, severe ataxia, polyneuropathy, lower limb spastic paraparesis with pyramidal signs, and gonadal dysgenesis. Psychiatric symptoms such as depression and paranoia were present as well. Brain MRI observed progressive cerebellar hyperintensive signs associated with cerebellar, medulla oblongata and cervical spinal cord atrophy. Light microscopy of the muscle biopsy detected severe neurogenic lesions. COX staining was centrally reduced in many muscle fibers. Both muscle and sural nerve electron microscopy detected slightly enlarged mitochondria with abnormal cristae surrounded by lipid vacuoles. In the sural nerve, dystrophic axons had focally uncompacted myelin lamellae present. Genetic investigation revealed multiple mtDNA deletion and compound heterozygous mutations of the TWNK gene (c.1196 A > G, c.1358 G > A). This study demonstrates that TWNK associated Perrault syndrome has a much broader phenotype as originally published. The coexistence of severe hypoacusis, spastic limb weakness, ataxia, polyneuropathy, gonadal dysgensia, hyperintense signals in the cerebellum and the presence of the mtDNA multiple deletion could indicate the impairment of the TWNK gene. This is the first report about pyramidal tract involvement and cerebellar MRI alteration associated with TWNK-related Perrault syndrome.

    更新日期:2019-12-19
  • Homozygous variants in the HEXB and MBOAT7 genes underlie neurological diseases in consanguineous families
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-18
    Shazia Khan; Lettie E. Rawlins; Gaurav V. Harlalka; Muhammad Umair; Asmat Ullah; Shaheen Shahzad; Muhammad Javed; Emma L. Baple; Andrew H. Crosby; Wasim Ahmad; Asma Gul

    Neurological disorders are a common cause of morbidity and mortality within Pakistani populations. It is one of the most important challenges in healthcare, with significant life-long socio-economic burden. We investigated the cause of disease in three Pakistani families in individuals with unexplained autosomal recessive neurological conditions, using both genome-wide SNP mapping and whole exome sequencing (WES) of affected individuals. We identified a homozygous splice site variant (NM_000521:c.445 + 1G > T) in the hexosaminidase B (HEXB) gene confirming a diagnosis of Sandhoff disease (SD; type II GM2-gangliosidosis), an autosomal recessive lysosomal storage disorder caused by deficiency of hexosaminidases in a single family. In two further unrelated families, we identified a homozygous frameshift variant (NM_024298.3:c.758_778del; p.Glu253_Ala259del) in membrane-bound O-acyltransferase family member 7 (MBOAT7) as the likely cause of disease. MBOAT7 gene variants have recently been identified as a cause of intellectual disability (ID), seizures and autistic features. We identified two metabolic disorders of lipid biosynthesis within three Pakistani families presenting with undiagnosed neurodevelopmental conditions. These findings enabled an accurate neurological disease diagnosis to be provided for these families, facilitating disease management and genetic counselling within this population. This study consolidates variation within MBOAT7 as a cause of neurodevelopmental disorder, broadens knowledge of the clinical outcomes associated with MBOAT7-related disorder, and confirms the likely presence of a regionally prevalent founder variant (c.758_778del; p.Glu253_Ala259del) in Pakistan.

    更新日期:2019-12-19
  • Novel mutations identified in Chinese families with autosomal dominant congenital cataracts by targeted next-generation sequencing
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-16
    Shan Li; Jianfei Zhang; Yixuan Cao; Yi You; Xiuli Zhao

    Congenital cataract is a clinically and genetically heterogeneous visual impairment. The aim of this study was to identify causative mutations in five unrelated Chinese families diagnosed with congenital cataracts. Detailed family history and clinical data were collected, and ophthalmological examinations were performed using slit-lamp photography. Genomic DNA was extracted from peripheral blood of all available members. Thirty-eight genes associated with cataract were captured and sequenced in 5 typical nonsyndromic congenital cataract probands by targeted next-generation sequencing (NGS), and the results were confirmed by Sanger sequencing. Bioinformatics analysis was performed to predict the functional effect of mutant genes. Results from the DNA sequencing revealed five potential causative mutations: c.154 T > C(p.F52 L) in GJA8 of Family 1, c.1152_1153insG(p.S385Efs*83) in GJA3 of Family 2, c.1804 G > C(p.G602R) in BFSP1 of Family 3, c.1532C > T(p.T511 M) in EPHA2 of Family 4 and c.356G > A(p.R119H) in HSF4 of Family 5. These mutations co-segregated with all affected individuals in the families and were not found in unaffected family members nor in 50 controls. Bioinformatics analysis from several prediction tools supported the possible pathogenicity of these mutations. In this study, we identified five novel mutations (c.154 T > C in GJA8, c.1152_1153insG in GJA3, c.1804G > C in BFSP1, c.1532C > T in EPHA2, c.356G > A in HSF4) in five Chinese families with hereditary cataracts, respectively. NGS can be used as an effective tool for molecular diagnosis of genetically heterogeneous disorders such as congenital cataract, and the results can provide more effective clinical diagnosis and genetic counseling for the five families.

    更新日期:2019-12-17
  • LRCH1 polymorphisms linked to delayed encephalopathy after acute carbon monoxide poisoning identified by GWAS analysis followed by Sequenom MassARRAY® validation
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-16
    Jiapeng Gu; Jiao Zeng; Xi Wang; Xin Gu; Xiaoli Zhang; Ping Zhang; Fan Zhang; Yongkai Han; Yazhou Han; Hongxing Zhang; Wenqiang Li; Renjun Gu

    We explored the association of leucine-rich repeats and calponin homology domain containing 1 (LRCH1) gene polymorphisms with genetic susceptibility to delayed encephalopathy after acute carbon monoxide poisoning (DEACMP), which might provide a theoretical basis for the pathogenesis, diagnosis, and prognosis research of DEACMP. Four single nucleotide polymorphisms, rs1539177 (G/A), rs17068697 (G/A), rs9534475 (A/C), and rs2236592 (T/C), of LRCH1, selected as candidate genes through genome-wide association analysis, were genotyped in 661 patients (DEACMP group: 235 cases; ACMP group: 426 cases) using Sequenom Massarray®. The association analysis of four SNPs and LRCH1 was performed under different genetic models. LRCH1 polymorphisms (rs1539177, rs17068697, rs9534475) under additive and dominant genetic models were significantly associated with an increased risk of DEACMP, but no significant association under allele and recessive models was found. The LRCH1 rs2236592 polymorphism was susceptible to DEACMP only under the dominant model (TT/TC + CC, OR = 1.616, 95% CI: 1.092–2.390, P = 0.015784). In addition, the A allele gene of rs9534475 polymorphism in LRCH1 might increase the risk for DEACMP (OR = 1.273, 95% CI: 1.013–1.601, P = 0.038445). We found a significant association between the four LRCH1 polymorphisms and DEACMP. The allelic A of rs9534475 polymorphism in LRCH1 might be a risk factor for DEACMP.

    更新日期:2019-12-17
  • Correction to: Homozygous missense variant in the TTN gene causing autosomal recessive limb-girdle muscular dystrophy type 10
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-12
    Amjad Khan; Rongrong Wang; Shirui Han; Muhammad Umair; Safdar Abbas; Muhammad Ismail Khan; Mohammad A. Alshabeeb; Majid Alfadheland; Xue Zhang

    Please be advised that following publication of the original article [1], the authors have identified the following errors with the scientific content.

    更新日期:2019-12-13
  • Association of vitamin D receptor TaqI and ApaI genetic polymorphisms with nephrolithiasis and end stage renal disease: a meta-analysis
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-10
    Tajamul Hussain; Shaik M. Naushad; Anwar Ahmed; Salman Alamery; Arif A. Mohammed; Mohamed O. Abdelkader; Nasser Abobakr Nasser Alkhrm

    The deficiency of vitamin D receptor (VDR) or its ligand, vitamin D3, is linked to the development of renal diseases. The TaqI (rs731236) and ApaI (rs7975232) polymorphisms of VDR gene are widely studied for their association with renal disease risk. However, studies have largely been ambiguous. Meta-analysis was carried out to clarify the association of TaqI (2777 cases and 3522 controls) and ApaI (2440 cases and 3279 controls) polymorphisms with nephrolithiasis (NL), diabetic nephropathy (DN) and end stage renal disease (ESRD). The VDR TaqI C-allele under allele contrast was significantly associated with ESRD in both fixed effect and random effect models, and ApaI C-allele with ESRD only under fixed effect model. Cochrane Q-test showed no evidence of heterogeneity for TaqI polymorphism and a significant heterogeneity for Apa I polymorphism. No publication bias was observed for both the polymorphisms. The present meta-analysis identifies TaqI and ApaI polymorphisms of VDR gene as risk factors for renal diseases.

    更新日期:2019-12-11
  • Novel gene mutation in von Hippel-Lindau disease – a report of two cases
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-10
    Jitian Wang; Wenjie Cao; Zhaoxia Wang; Hong Zhu

    Von Hippel-Lindau (VHL) syndrome is a familial autosomal dominant hereditary neoplastic disease caused by mutations in the VHL gene. Approximately 503 kinds of VHL gene mutations have been reported. Different types of mutations manifest various clinical phenotypes, from benign to malignant tumours or coexisting cysts. Thus, a gene mutation test is essential in the diagnosis of VHL syndrome. We reported two cases in which a novel mutation site in the c530-536delGACTGGA region in exon 3 of the VHL gene resulted in the development of VHL syndrome. According to the ACMG guidelines, this variation is pathogenic and consistent with autosomal dominant inheritance. This variation has not been reported anywhere in the databases or literature. This report will add a new mutation site to VHL gene databases. The newly added gene mutation and its associated clinical phenotypes will help improve the accuracy of VHL diagnosis and benefit the community of VHL gene mutation carriers.

    更新日期:2019-12-11
  • An analysis of mutational signatures of synonymous mutations across 15 cancer types
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-09
    Yannan Bin; Xiaojuan Wang; Le Zhao; Pengbo Wen; Junfeng Xia

    Synonymous mutations have been identified to play important roles in cancer development, although they do not modify the protein sequences. However, relatively little research has specifically delineated the functionality of synonymous mutations in cancer. We investigated the nucleotide-based and amino acid-based features of synonymous mutations across 15 cancer types from The Cancer Genome Atlas (TCGA), and revealed novel driver candidates by identifying hotspot mutations. Firstly, synonymous mutations were analyzed between TCGA and 1000 Genomes Project at nucleotide and amino acid levels. We found that C:G → T:A transitions were the most frequent single-base substitutions, and leucine underwent the largest number of synonymous mutations in TCGA due to prevalent C → T transition, which induced the transformation between optimal and non-optimal codons. Next, 97 synonymous hotspot mutations in 86 genes were nominated as candidate drivers with potential cancer risk by considering the mutational rates across different sequence contexts. We observed that non-CpG-island GC transition sequence context was positively selected across most of cancer types, and different sequence contexts under which hotspot mutations occur could be significance for genetic differences and functional features. We also found that the hotspots were more conserved than neutral mutations of hotspot-mutation-containing-genes and frequently happened at leucine. In addition, we mapped hotspots, neutral and non-hotspot mutations of hotspot-mutation-containing-genes to their respective protein domains and found ion transport domain was the most frequent one, which could mediate the cell interaction and had relevant implication for tumor therapy. And the signatures of synonymous hotspots were qualitatively similar with those of harmful missense variants. We illustrated the preferences of cancer associated synonymous mutations, especially hotspots, and laid the groundwork for understanding the synonymous mutations act as drivers in cancer.

    更新日期:2019-12-09
  • COL5A1 rs12722 polymorphism is not associated with passive muscle stiffness and sports-related muscle injury in Japanese athletes
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-02
    Eri Miyamoto-Mikami; Naokazu Miyamoto; Hiroshi Kumagai; Kosuke Hirata; Naoki Kikuchi; Hirofumi Zempo; Noriko Kimura; Nobuhiro Kamiya; Hiroaki Kanehisa; Hisashi Naito; Noriyuki Fuku

    Poor joint flexibility has been repeatedly proposed as a risk factor for muscle injury. The C-to-T polymorphism (rs12722) in the 3′-untranslated region of the collagen type V α1 chain gene (COL5A1) is reportedly associated with joint flexibility. Flexibility of a normal joint is largely determined by passive muscle stiffness, which is influenced by intramuscular collagenous connective tissues including type V collagen. The present study aimed to test the hypothesis that the COL5A1 rs12722 polymorphism influences joint flexibility via passive muscle stiffness, and is accordingly associated with the incidence of muscle injury. In Study 1, we examined whether the rs12722 polymorphism is associated with joint flexibility and passive muscle stiffness in 363 healthy young adults. Joint flexibility was evaluated by passive straight-leg-raise and sit-and-reach tests, and passive muscle stiffness was measured using ultrasound shear wave elastography. In Study 2, the association of the rs12722 polymorphism with sports-related muscle injury was assessed in 1559 Japanese athletes. Muscle injury history and severity were assessed by a questionnaire. In both Study 1 and Study 2, the rs12722 C-to-T polymorphism in the COL5A1 was determined using the TaqMan SNP Genotyping Assay. Study 1 revealed that the rs12722 polymorphism had no significant effect on range of motion in passive straight-leg-raise and sit-and-reach tests. Furthermore, there was no significant difference in passive muscle stiffness of the hamstring among the rs12722 genotypes. In Study 2, rs12722 genotype frequencies did not differ between the muscle injury and no muscle injury groups. Moreover, no association was observed between rs12722 polymorphism and severity of muscle injury. The present study does not support the view that COL5A1 rs12722 polymorphism has a role as a risk factor for sports-related muscle injury, or that it is a determinant for passive muscle stiffness in a Japanese population.

    更新日期:2019-12-03
  • Identification of key pathways and genes in PTEN mutation prostate cancer by bioinformatics analysis
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-12-02
    Jian Sun; Shugen Li; Fei Wang; Caibin Fan; Jianqing Wang

    Prostate cancer (Pca) remains one of the leading adult malignancies. PTEN (Phosphatase and Tensin Homolog) mutant is the top common mutated genes in prostate cancer, which makes it a promising biomarker in future individualized treatment. We obtained gene expression data of prostate cancer from TCGA (The Cancer Genome Atlas) database for analysis. We analyzed the DEGs (differentially expressed genes), and used online tools or software to analyze Gene ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG), Gene set enrichment analysis (GSEA), Search Tool for the Retrieval of Interacting Genes/Proteins, and Molecular Complex Detection. Latest TCGA data showed PTEN mutation in about 22% patients. 1736 DEGs in total were identified. Results of gene functional enrichment analyses showed that muscle contraction, negative regulation of growth and multiple metabolic progression were significantly enriched. GNG13, ACTN2, POTEE, ACTA1, MYH6, MYH3, MYH7, MYL1, TNNC1 and TNNC2 were the top ten hub genes. Patients with PTEN mutation showed relatively decreased mRNA expression level of PTEN. Survival analysis indicated the risk of disease recurrence in patients with PTEN mutation. Our findings suggested that PTEN mutation in prostate cancer may induce changes in a variety of genes and pathways and affect disease progression, suggesting the significance of PTEN mutation in individualized treatment of prostate cancer.

    更新日期:2019-12-02
  • Genetic variation in interleukin-7 is associated with a reduced erythropoietic response in Kenyan children infected with Plasmodium falciparum
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-08-16
    Lily E. Kisia; Prakasha Kempaiah; Samuel B. Anyona; Elly O. Munde; Angela O. Achieng; John M. Ong’echa; Christophe G. Lambert; Kiprotich Chelimo; Collins Ouma; Douglas J. Perkins ; Evans Raballah

    Severe malarial anemia (SMA) is a leading cause of malaria-related morbidity and mortality in children. The genetic factors that influence development of SMA and inefficient erythropoiesis, a central pathogenic feature of SMA, are only partially understood. We performed a pilot Genome-wide Association Study (GWAS) on children with Plasmodium falciparum. The GWAS was performed using the Illumina® Infinium® HD Super Assay in conjunction with Illumina’s® Human Omni2.5-8v1 BeadChip (with > 2.45 M markers). Data were analyzed using single SNP logistic regression analysis with an additive model of inheritance controlling for covariates. Results from our pilot global genomics study identified that variation in interleukin (IL)-7 was associated with enhanced risk of SMA. To validate this finding, we investigated the relationship between genotypes and/or haplotypes of two single nucleotide polymorphisms (SNPs) in IL7 [72194 T/C and − 2440 A/G] and susceptibility to both SMA and inefficient erythropoiesis [i.e., reticulocyte production index (RPI) < 2.0 in anemic children (Hb < 11.0 g/dL). Children presenting with P. falciparum malaria (< 3 years, n = 883) were stratified into two groups: Uncomplicated malaria (UM, n = 718) and SMA (n = 165). Regression modeling, controlling for anemia-related confounders, revealed that carriage of the TC genotype at position 72194 T/C was associated with enhanced susceptibility to inefficient erythropoiesis (OR = 1.90; 95% CI 1.09–3.30; P = 0.02) as was homozygous CC (OR 5.14; 95% CI = 1.20–21.99; P = 0.03). Consistent with this finding, individuals with the CA (72194C/−2440A) haplotype had an increased risk of inefficient erythropoiesis (OR = 1.90; 95% CI = 1.10–3.30; P = 0.02), whereas TA haplotype carriers had marginal protection against inefficient erythropoiesis (OR = 0.24; 95% CI = 0.06–1.21; P = 0.05). These observations were supported by Cochran-Armitage trend test for inefficient erythropoiesis (CA > TA > CG; P < 0.01). Although none of the genotype and/or haplotypic variants were significantly associated with SMA, the direction of the risk profiles were consistent with the erythropoiesis results. Taken together, variation in IL7 is associated with erythropoietic responses in children with falciparum malaria, a central physiological feature contributing to development of SMA.

    更新日期:2019-11-28
  • Association of hypoxia-inducible factor-1α (HIF1α) 1790G/A gene polymorphism with renal cell carcinoma and prostate cancer susceptibility: a meta-analysis
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-08-16
    Hong-Yan Li; Tianbiao Zhou; Wenshan Lin; Shujun Lin; Hongzhen Zhong

    This meta-analysis was performed to evaluate the relationship between hypoxia-inducible factor-1α (HIF1α) 1790G/A gene polymorphism and the susceptibility to renal cell carcinoma (RCC) and prostate cancer (PCa). Association investigations were identified and included from the Embase, Cochrane Library and PubMed databases on March 1, 2018, and eligible investigations were analyzed by meta-analysis. Odds ratios (OR) were used to express the dichotomous data, and the 95% confidence intervals (CI) were also calculated. In this meta-analysis, we found that the AA genotype of HIF1α 1790G/A was positively associated with the risk of RCC in overall populations, Caucasians, but not for Asians. G allele and GG genotype were not associated with the susceptibility of RCC in overall populations, Caucasians, and Asians. The G allele was negatively associated with PCa susceptibility in overall populations, Asians, but not for Caucasians. GG genotype was negatively associated with PCa susceptibility in Asians, but not for overall populations and Caucasians. HIF1α 1790G/A AA genotype was not associated with PCa susceptibility in overall populations of Caucasians or Asians. AA genotype of HIF1α 1790G/A was positively associated with RCC risk in overall populations and Caucasians. Furthermore, the G allele was negatively associated with prostate cancer susceptibility in overall populations, Asians, and GG genotype was negatively associated with PCa susceptibility in Asians.

    更新日期:2019-11-28
  • Relationship between the rs2596542 polymorphism in the MICA gene promoter and HBV/HCV infection-induced hepatocellular carcinoma: a meta-analysis
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-08-16
    Xiaojun Luo; Yu Wang; Ai Shen; Hejun Deng; Min Ye

    Various studies have investigated the relationship between the polymorphism, rs2596542, in the promoter of the major histocompatibility complex class I-related gene A (MICA) gene with susceptibility to hepatitis B virus (HBV)/ hepatitis C virus (HCV)-induced hepatocellular carcinoma (HCC); however, the results are inconclusive. This meta-analysis was conducted to investigate the relationship between rs2596542 and HCV/HBV-induced HCC. Three electronic scientific publication databases (MEDLINE, Web of Science, and Embase) were screened using specific search terms and relevant literature identified using literature traceability methods. Selected publications were evaluated according to the inclusion and exclusion criteria, and 11 articles were included in the study. Effect size information (odds ratio [OR] and corresponding 95% confidence interval [CI]) were obtained following quality assessment and data extraction from the included publications, and a meta-analysis conducted. A total of 11 publications were included in the study, including 4582 patients with HCC and 21,095 non-HCC patients. TT genotype at rs2596542 was a risk factor for the development of HCC in patients with HCV/HBV infection (OR = 1.248, 95% CI: 1.040–1.499, P = 0.017), particularly those with HCV infection (OR = 1.326, 95% CI: 1.101–1.599, P = 0.003) and Asians (OR = 1.273, 95% CI: 1.002–1.618, P = 0.048), or when the control group was patients with chronic hepatitis C (CHC) (OR = 1.506, 95% CI: 1.172–1.936, P = 0.001). The findings of this meta-analysis suggest that the rs2596542 variant in the MICA promoter region may affect MICA and soluble MICA (sMICA) protein expression, thereby influencing physiological vulnerability to HCC cells and the development of HCC. These data provide a theoretical basis for the diagnosis and treatment of patients with HCC and viral hepatitis infection.

    更新日期:2019-11-28
  • Autoimmune Polyglandular Syndrome Type 1: a case report
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-08-16
    Sayed Mahmoud Sajjadi-Jazi; Akbar Soltani; Samaneh Enayati; Armita Kakavand Hamidi; Mahsa M. Amoli

    Mutations of the autoimmune regulator gene (AIRE), located on chromosome 21q22.3, are recognized as the cause of a rare monogenic organ-specific autoimmune disorder called autoimmune polyglandular syndrome type 1 (APS-1). Three major components of this syndrome include chronic mucocutaneous candidiasis (CMC), hypoparathyroidism, and adrenocortical failure. We report a 19-year-old girl, who was born in an Iranian Muslim family with a clinical diagnosis of APS-1. To identify the causative mutation, a direct sequencing of the entire AIRE gene sequence was performed by Sanger sequencing method. Three distinct variants were discovered, including c.1095 + 2 T > A, c.1197 T > C (rs1800521) and c.1578 T > C (rs1133779), in intron 9, exons 10 and 14 of the AIRE gene, respectively. To the best of our knowledge, this is the first report of an Iranian Muslim APS-1 patient with combination of these variations. In addition, the effect of c.1095 + 2 T > A mutation on AIRE mRNA expression was reported for the first time. This study expands the diversity of variants that could cause APS-1. More genetic studies are required to determine the exact frequency of these variants and their diagnostic significance.

    更新日期:2019-11-28
  • MC4R variants rs12970134 and rs17782313 are associated with obese polycystic ovary syndrome patients in the Western region of Saudi Arabia
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-08-20
    Asma A. Batarfi; Najlaa Filimban; Osama S. Bajouh; Ashraf Dallol; Adeel G. Chaudhary; Sherin Bakhashab

    Polycystic ovary syndrome (PCOS) is a common endocrine disorder causing infertility in reproductive-age women. The cause of PCOS is not fully understood but it is thought to be influenced by environmental and genetic factors. Obesity is greatly related to PCOS and its reduction is one of the major aims in treating PCOS. Melanocortin 4 receptor (MC4R) gene polymorphisms were detected to be associated with different levels of obesity. Therefore, we aimed to determine the genotype and allele frequency of MC4R variants rs12970134 (A/G) and rs17782313 (C/T) in PCOS and investigate their association with PCOS and its clinical variables. A case-control study was conducted on 189 women, consisting of 95 PCOS cases and 94 controls. Genotyping was performed by real-time polymerase chain reaction (PCR) using TaqMan™ Genotyping assays. Quantitative data were presented as (median ± interquartile range (IQR) whereas qualitative data were presented as frequencies. The chi-squared test was used to observe the difference between SNPs within the study groups (PCOS and control subjects). Multinomial logistic regression was used to test the risk of obesity and development of PCOS considering p < 0.05 is statistically significant. Rs12970134 and rs17782313 are significantly associated with body mass index (BMI, kg/m2, p < 0.0001) in PCOS women but not associated with PCOS itself. Risk alleles in our population are A in rs12970134 and C in rs17782313 that are associated with high BMI (> 30 kg/m2) in obese women with PCOS (OR = 1.348, p = 0.002 and OR = 1.364, p = 0.002 respectively) in the homozygous state. In addition, we found that the other genotypes for non-obese PCOS group, AG/GG for rs12970134 and CT/TT for rs17782313, are associated with hirsutism, loss of hair, hyperandrogenism and anti-Müllerian hormone in PCOS. These findings demonstrate that MC4R single nucleotide polymorphisms, rs12970134 and rs17782313, are correlated with elevated BMI in PCOS but are not causative factors for PCOS among women in the western region of Saudi Arabia. Moreover, the reverse genotypes are associated with major clinical variants in non-obese (< 30 kg/m2) PCOS patients may demonstrate a poor prognosis for this group.

    更新日期:2019-11-28
  • Novel nonsense variants in SLURP1 and DSG1 cause palmoplantar keratoderma in Pakistani families
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-08-23
    Abida Akbar; Claire Prince; Chloe Payne; James Fasham; Wasim Ahmad; Emma L. Baple; Andrew H. Crosby; Gaurav V. Harlalka; Asma Gul

    Inherited palmoplantar keratodermas (PPKs) are clinically and genetically heterogeneous and phenotypically diverse group of genodermatoses characterized by hyperkeratosis of the palms and soles. More than 20 genes have been reported to be associated with PPKs including desmoglein 1 (DSG1) a key molecular component for epidermal adhesion and differentiation. Mal de Meleda (MDM) is a rare inherited autosomal recessive genodermatosis characterized by transgrediens PPK, associated with mutations in the secreted LY6/PLAUR domain containing 1 (SLURP1) gene. This study describes clinical as well as genetic whole exome sequencing (WES) and di-deoxy sequencing investigations in two Pakistani families with a total of 12 individuals affected by PPK. WES identified a novel homozygous nonsense variant in SLURP1, and a novel heterozygous nonsense variant in DSG1, as likely causes of the conditions in each family. This study expands knowledge regarding the molecular basis of PPK, providing important information to aid clinical management in families with PPK from Pakistan.

    更新日期:2019-11-28
  • Whole exome sequencing reveals two novel compound heterozygous mutations in TWNK as a cause of the hepatocerebral form of mitochondrial DNA depletion syndrome: a case report
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-08-27
    Xianghong Li; Liangshan Li; Yaqi Sun; Fuyan Lv; Guoqing Zhang; Wenmiao Liu; Meiyan Zhang; Hong Jiang; Shiguo Liu

    Although Mitochondrial DNA depletion syndrome (MDS) can be classified into three forms: myopathic, encephalomyopathic and hepatocerebral form, it is difficult to identify its form due to its clinical heterogeneity. Therefore, it is very important to conduct molecular genetic analysis on suspected patients. This study presented a male 38 weeks and 5 days infant with liver cytolysis and leukodystrophy. A male infant proband was admitted to the department of NICU for feeding intolerance, irregular rhythm of respiration, hypoglycemia, lactic acidosis, liver cytolysis and neurological abnormalities. He was onset of mild jaundice with leukodystrophy and high lactate and phenylderivatives for urine organic acids on the 7th day. Whole exome sequencing (WES) and Sanger sequencing were performed to screen and confirm the suspicious pathogenic mutations. The results revealed this proband carried two compound heterozygous mutations in TWNK: c.1186 C > T / p.Pro396Ser and c.1844 G > C / p.Gly615Ala inherited by an autosomal recessive form from his parents, of which protein conservative analysis and structural modeling supported the pathogenicity of the two mutations. Unfortunately, the conditions described above were not improved until he was discharged from the hospital on the 23rd day and died at 4 months of age. In this study, we investigated a Chinese family with the hepatocerebral form of MDS and conducted WES and Sanger sequencing to explore the causative mutations for this proband born from non-consanguineous and healthy parents. We identified two novel TWNK c.1186 C > T/ c.1844 G > C compound heterozygous mutations which were probably the disease-causing mutations of hepatocerebral form of MDS and described the clinical manifestations of the proband, which expanded the phenotypic spectrum of MDS caused by variants in TWNK. This study also emphasized WES technology can provide the genetic diagnosis of Mendelian genetic disease.

    更新日期:2019-11-28
  • A novel homozygous frame-shift mutation in the SLC29A3 gene: a new case report and review of literature
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-08-29
    Sadaf Noavar; Samira Behroozi; Taraneh Tatarcheh; Farshid Parvini; Majid Foroutan; Hossein Fahimi

    The SLC29A3 gene, encoding a nucleoside transporter protein, is found in intracellular membranes. Based on the literatures, mutations in this gene cause a wide range of clinical manifestations including H syndrome, pigmented hypertrichosis with insulin dependent diabetes, Faisalabad histiocytosis, and dysosteosclerosis. However, all these disorders with their different names and terminologies are actually the same entity termed H syndrome. We report four GJB2 and GJB6 negative deaf patients from two Iranian related families who present the associated symptoms of SLC29A3-disorder. Whole Exome Sequencing (WES) using Next Generation Illumina Sequencing was used to enrich all exons of protein-coding genes as well as some other important genomic regions in one of studied patients. A novel homozygous frame-shift mutation c.307-308delTT (p.Phe103fs) in exon 3 of SLC29A3 gene was identified in a 35 years old man with profound hearing loss, camptodactyly, rheumatoid arthritis and delayed puberty without any skin changes, short stature and insulin dependent diabetes mellitus. The mutation found was also confirmed by Sanger sequencing in other studied patients and their healthy parents. In compared to proband, however the clinical manifestations of these patients were different, indicating variable expressivity of mutant SLC29A3 gene as well as possible involvement of other modifier genes. The present study uncovered a rare novel homozygous frame-shift mutation c.307-308delTT in SLC29A3 gene of four related patients with various manifestation of SLC29A3-disorder. Such studies can help to conduct genetic counseling and subsequently, prenatal diagnosis more accurately for individuals at the high risk of these types of genetic disorders.

    更新日期:2019-11-28
  • Association of CYP gene polymorphisms with breast cancer risk and prognostic factors in the Jordanian population
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-09-02
    Laith N. AL-Eitan; Doaa M. Rababa’h; Mansour A. Alghamdi; Rame H. Khasawneh

    Single nucleotide polymorphisms (SNPs) in several CYP genes have been associated with altered breast cancer (BC) risk in different populations. Despite this, there is a dearth of information on the roles of these SNPs in Jordanian BC patients. Therefore, this study aims to determine if there is any single nucleotide polymorphism (SNP) within CYP19A1, CYP2C19, CYP2C9, CYP1B1, CYP3A4, and CYP1A2 genes associated with BC in the Jordanian population. In addition, this work investigates the association between selected BC prognostic factors and variants of the aforementioned CYP candidate genes. Blood samples were withdrawn from 221 BC patients and 218 healthy volunteers recruited from the Jordanian population. Genomic DNA was withdrawn and, after quantification and quality control, was genotyped using the Sequenom MassARRAY® system (iPLEX GOLD). Statistical analysis was then carried out to assess allelic and genotypic frequencies as well as genetic association between cases and controls. The CYP19A1 SNP rs7176005 (p < 0.0045) and the CYP1A2 SNP rs762551 (p = 0.004) were significantly associated with BC risk. However, no such association was found for the screened SNPs of the CYP2C9, CYP1B1, CYP2C19 and CYP3A4 genes. Regarding the prognostic factors of BC, several of the screened SNPs were associated with different pathological and clinical features. Certain CYP genes, particularly CYP19A1 and CYP1A2, were associated with BC risk and development in the Jordanian population.

    更新日期:2019-11-28
  • Genetic basis of rotator cuff injury: a systematic review
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-09-02
    Umile Giuseppe Longo; Vincenzo Candela; Alessandra Berton; Giuseppe Salvatore; Andrea Guarnieri; Joseph DeAngelis; Ara Nazarian; Vincenzo Denaro

    Rotator cuff disease is a widespread musculoskeletal pathology and a major cause of shoulder pain. Studies on familial predisposition suggest that genetic plays a role in the pathogenesis of rotator cuff disease. Several genes are responsible for rotator cuff disease. The aim of this study was to perform a systematic review on genetic association between rotator cuff disease and genes variations. A systematic review of the literature was performed, in accordance with the PRISMA guidelines. PubMed, Medline, CINAHL, Cochrane, Embase and Google Scholar databases were searched comprehensively using the keywords: “Rotator cuff”, “Gene”, “Genetic”, “Predisposition”, “Single-nucleotide polymorphism” and “Genome-wide association”. 8 studies investigating genes variations associated with rotator cuff tears were included in this review. 6 studies were case-control studies on candidate genes and 2 studies were GWASs. A significant association between SNPs and rotator cuff disease was found for DEFB1, FGFR1, FGFR3, ESRRB, FGF10, MMP-1, TNC, FCRL3, SASH1, SAP30BP, rs71404070 located next to cadherin8. Contradictory results were reported for MMP-3. Further investigations are warranted to identify complete genetic profiles of rotator cuff disease and to clarify the complex interaction between genes, encoded proteins and environment. This may lead to individualized strategies for prevention and treatment of rotator cuff disease. Level IV, Systematic Review.

    更新日期:2019-11-28
  • Novel mutations in actionable breast cancer genes by targeted sequencing in an ethnically homogenous cohort
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-09-02
    Hosneara Akter; Nasima Sultana; Nazrana Martuza; Aaysha Siddiqua; Nushrat Jahan Dity; Md. Atikur Rahaman; Bisan Samara; Ahmed Sayeed; Mohammed Basiruzzaman; Mohammad Mizanur Rahman; Md. Rashidul Hoq; Md. Robed Amin; Md. Abdul Baqui; Marc Woodbury-Smith; K. M. Furkan Uddin; Syed S. Islam; Rayhana Awwal; Bakhrom K. Berdiev; Mohammed Uddin

    Genetic testing is becoming an essential tool for breast cancer (BC) diagnosis and treatment pathway, and particularly important for early detection and cancer prevention. The purpose of this study was to explore the diagnostic yield of targeted sequencing of the high priority BC genes. We have utilized a cost-effective targeted sequencing approach of high priority actionable BC genes (BRCA1, BRCA2, ERBB2 and TP53) in a homogeneous patient cohort from Bangladesh (n = 52) by using tumor and blood samples. Blood derived targeted sequencing revealed 25.58% (11/43) clinically relevant mutations (both pathogenic and variants of uncertain significance (VUS)), with 13.95% (6/43) of samples carrying a pathogenic mutations. We have identified and validated five novel pathogenic germline mutations in this cohort, comprising of two frameshift deletions in BRCA2, and missense mutations in BRCA1, BRCA2 and ERBB2 gene respectively. Furthermore, we have identified three pathogenic mutations and a VUS within three tumor samples, including a sample carrying pathogenic mutations impacting both TP53 (c.322dupG; a novel frameshift insertion) and BRCA1 genes (c.116G > A). 22% of tissue samples had a clinically relevant TP53 mutation. Although the cohort is small, we have found pathogenic mutations to be enriched in BRCA2 (9.30%, 4/43) compare to BRCA1 (4.65%, 2/43). The frequency of germline VUS mutations found to be similar in both BRCA1 (4.65%; 2/43) and BRCA2 (4.65%; 2/43) compared to ERBB2 (2.32%; 1/43). This is the first genetic study of BC predisposition genes in this population, implies that genetic screening through targeted sequencing can detect clinically significant and actionable BC-relevant mutations.

    更新日期:2019-11-28
  • Genetic polymorphism in DGCR8 is associated with late onset of preeclampsia
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-09-04
    Xin Huang; Zuodong Li; Jun Lei; Dapeng Wang; Yujing Zhang

    PE (preeclampsia) is a heterogeneous disorder with early onset PE (EOPE) and late onset PE (LOPE) subtypes. Associations between maternal miRNAs biosynthesis genes polymorphisms and risk of PE have been previously observed. However, the impact of polymorphisms in DGCR8 which is indispensable in miRNA maturing processing on the susceptibility to preeclampsia (PE) has not been elucidated yet. We, therefore, conducted a case-control study to evaluate the impact of polymorphisms in DGCR8 on the risk of EOPE and LOPE. A total of 66 patients diagnosed with EOPE, 206 with LOPE and 330 healthy controls were recruited. Five SNPs in DGCR8 were genotyped including rs1558496, rs1640299, rs720012, rs720014, and rs9606241. Logistic regression was used to estimate the OR and the 95% CI for the associations. Increased risk of LOPE has been observed among patients with rs1640299 TG genotype (OR = 1.98 (95%CI: 1.38, 2.87), p = 2.32e-4) and rs720014 TC genotype (OR = 2.49 (95%CI: 1.72, 3.60), p = 1.40e-7). The DGCR8 rs1558496/ rs1640299/ rs720012/ rs720014/ rs9606241 haplotype T-G-A-C-A and T-G-A-C-G were associated with increased risk of LOPE (OR = 2.20 (95%CI: 1.49, 3.25), p = 5.90e-5, and 1.58 (95%CI: 1.06, 2.36), p = 0.024, respectively). And the haplotype T-T-G-T-A was associated with lower risk of LOPE (OR = 0.74 (95%CI: 0.58, 0.95), p = 0.018). These significant associations retained after false-positive discovery rate correction. However, none of the tested SNPs or haplotypes in DGCR8 gene is associated with risk of EOPE (p > 0.05). Polymorphisms in DGCR8 might participate in the pathological process of preeclampsia. The rs1640299 T > G and rs720014 T > C polymorphisms are associated with late onset preeclampsia susceptibility.

    更新日期:2019-11-28
  • Screening of 31 genes involved in monogenic forms of obesity in 23 Pakistani probands with early-onset childhood obesity: a case report
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-09-05
    Robina Khan Niazi; Anette Prior Gjesing; Mette Hollensted; Christian Theil Have; Dmitrii Borisevich; Niels Grarup; Oluf Pedersen; Asmat Ullah; Gulbin Shahid; Ifrah Shafqat; Asma Gul; Torben Hansen

    Consanguine families display a high degree of homozygosity which increases the risk of family members suffering from autosomal recessive disorders. Thus, homozygous mutations in monogenic obesity genes may be a more frequent cause of childhood obesity in a consanguineous population. We identified 23 probands from 23 Pakistani families displaying autosomal recessive obesity. We have previously excluded mutations in MC4R, LEP and LEPR in all probands. Using a chip-based, target-region capture array, 31 genes involved in monogenic forms of obesity, were screened in all probands. We identified 31 rare non-synonymous possibly pathogenic variants (28 missense and three nonsense) within the 31 selected genes. All variants were heterozygous, thus no homozygous pathogenic variants were found. Two of the rare heterozygous nonsense variants identified (p.R75X and p.R481X) were found in BBS9 within one proband, suggesting that obesity is caused by compound heterozygosity. Sequencing of the parents supported the compound heterozygous nature of obesity as each parent was carrying one of the variants. Subsequent clinical investigation strongly indicated that the proband had Bardet-Biedl syndrome. Mutation screening in 31 genes among probands with severe early-onset obesity from Pakistani families did not reveal the presence of homozygous obesity causing variants. However, a compound heterozygote carrier of BBS9 mutations was identified, indicating that compound heterozygosity must not be overlooked when investigating the genetic etiology of severe childhood obesity in populations with a high degree of consanguinity.

    更新日期:2019-11-28
  • The identification and characterization of the p.G91 deletion in CRYBA1 in a Chinese family with congenital cataracts
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-09-05
    Dan Li; Qinghe Jing; Yongxiang Jiang

    Mutations in more than 52 genes have been identified in isolated congenital cataracts, the majority of which are located in crystalline and connexin (gap junction) genes. An in-frame one amino acid deletion in the beta-crystalline gene CRYBA1 has been reported in several different Chinese, Caucasian and Iranian families of congenital cataracts. Further functional studies are needed to confirm the variant pathogenicity. The purpose of this study is to identify the genetic causes that contribute to congenital cataracts with esotropia and nystagmus in a Chinese family. Whole-exome sequencing was performed on samples from all five family members. The two brothers of the father and their daughters were then enrolled in the study, and 40 suspected variants were sequenced among the 9 subjects using Sanger sequencing. The mRNA and protein levels of CRYBA1 in the lens epithelium from cataract patients and normal controls were compared using quantitative polymerase chain reaction (qPCR) and Western blot analyses. The wild-type and mutated forms (p.G91del) of CRYBA1 cDNA were transfected into two types of cell lines, and the expression level of exogenous CRYBA1 was measured by Western blot analysis. The exogenous CRYBA1 proteins were visualized by immunofluorescence staining. In this two-generation family, all three descendants inherited congenital cataracts with esotropia and nystagmus from the father, while the mother’s lens was normal. After two rounds of sequencing, CRYBA1 (c. 269–271 del, p.G91del) was identified as the mutation responsible for the autosomal dominant congenital cataract in the Chinese family. CRYBA1 showed lower expression in cataract lenses than in control lenses. The deleted form (p.G91del) of CRYBA1 showed lower expression and was more aggregate to the cell membrane than the wild-type CRYBA1. We performed molecular experiments to confirm that the p.G91del mutation in CRYBA1 results in abnormal expression and distribution of CRYBA1 protein, and this study could serve as an example of the pathogenicity of an in-frame small deletion in an inherited eye disorder.

    更新日期:2019-11-28
  • BRCA mutations in a cohort of Iraqi patients presenting to a tertiary referral center
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-09-05
    Chantal Farra; Christelle Dagher; Lama Hamadeh; Nagi El Saghir; Deborah Mukherji

    Unique pathogenic mutations in BRCA1 and 2 genes have been reported in different populations of patients originating from the Middle East region. Limited data are available for the Iraqi population. For many reasons a large number of Iraqi patients present to Lebanon for medical care. This is the first report of BRCA full gene sequencing conducted in a cohort of high-risk patients originating from Iraq. This is a retrospective review of Iraqi patients diagnosed with breast or ovarian cancer referred for BRCA mutation testing at the American University of Beirut from January 2012 to October 2018. Of the 42 Iraqi women who underwent genetic testing at our institution, 3 BRCA pathogenic variants were found. Two mutations in BRCA1 c.224_227delAAAG and c.5431C > T and one mutation in BRCA2 c.5576_5579delTTAA were identified. Three other patients had sequence changes considered as variants of undetermined significance. In this cohort of high-risk patients, one out of the three pathogenic BRCA variants detected has not previously been reported in the Middle Eastern population. Further studies are required to delineate the spectrum of BRCA mutations in the Iraqi population.

    更新日期:2019-11-28
  • Genetic variants in CYP4F2 were significantly correlated with susceptibility to ischemic stroke
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-09-11
    Yuan Wu; Junjie Zhao; Yonglin Zhao; Tingqin Huang; Xudong Ma; Honggang Pang; Ming Zhang

    Ischemic stroke (IS) is a serious cardiovascular disease and is associated with several single nucleotide polymorphisms (SNPs). However, the role of Cytochrome P450 family 4 subfamily F member 2 (CYP4F2) gene in IS remains unknown. Our study aimed to explore whether CYP4F2 polymorphisms influenced IS risk in the Han Chinese population. We selected 477 patients and 495 controls to do a case-control study, and five SNPs in CYP4F2 gene were successfully genotyped. And we evaluated the associations using the Chi-squared test, independent sample t test, and genetic models analyses. Logistic regression analysis was used to calculate odds ratios (ORs) and 95% confidence intervals (CIs). In this study, rs12459936 and rs3093144 were associated with IS risk in the overall. After stratified analysis by age (> 61 years), rs3093193 and rs3093144 were related to an increased risk of IS, whereas rs12459936 was related to a decreased risk of IS. In addition, we found that three SNPs (rs3093193, rs3093144 and rs12459936) were associated with the susceptibility to IS in males. We also found five SNPs in the CYP4F2 gene had strong linkage. Three SNPs (rs3093193, rs3093144 and rs12459936) in the CYP4F2 were associated with IS risk in a Chinese Han population. And, CYP4F2 gene may be involved in the development of IS.

    更新日期:2019-11-28
  • Clinical course, mutations and its functional characteristics of infantile-onset Pompe disease in Thailand
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-09-11
    Lukana Ngiwsara; Duangrurdee Wattanasirichaigoon; Thipwimol Tim-Aroon; Kitiwan Rojnueangnit; Saisuda Noojaroen; Arthaporn Khongkraparn; Phannee Sawangareetrakul; James R. Ketudat-Cairns; Ratana Charoenwattanasatien; Voraratt Champattanachai; Chulaluck Kuptanon; Suthipong Pangkanon; Jisnuson Svasti

    Pompe disease is a lysosomal storage disorder caused by the deficiency of acid alpha-glucosidase (EC. 3.2.1.20) due to mutations in human GAA gene. The objective of the present study was to examine clinical and molecular characteristics of infantile-onset Pompe disease (IOPD) in Thailand. Twelve patients with infantile-onset Pompe disease (IOPD) including 10 Thai and two other Asian ethnicities were enrolled. To examine the molecular characteristics of Pompe patients, GAA gene was analyzed by PCR amplification and direct Sanger-sequencing of 20 exons coding region. The novel mutations were transiently transfected in COS-7 cells for functional verification. The severity of the mutation was rated by study of the GAA enzyme activity detected in transfected cells and culture media, as well as the quantity and quality of the proper sized GAA protein demonstrated by western blot analysis. The GAA three dimensional structures were visualized by PyMol software tool. All patients had hypertrophic cardiomyopathy, generalized muscle weakness, and undetectable or < 1% of GAA normal activity. Three patients received enzyme replacement therapy with variable outcome depending on the age of the start of enzyme replacement therapy (ERT). Seventeen pathogenic mutations including four novel variants: c.876C > G (p.Tyr292X), c.1226insG (p.Asp409GlyfsX95), c.1538G > A (p.Asp513Gly), c.1895 T > G (p.Leu632Arg), and a previously reported rare allele of unknown significance: c.781G > A (p.Ala261Thr) were identified. The rating system ranked p.Tyr292X, p. Asp513Gly and p. Leu632Arg as class “B” and p. Ala261Thr as class “D” or “E”. These novel mutations were located in the N-terminal beta-sheet domain and the catalytic domain. The present study provides useful information on the mutations of GAA gene in the underrepresented population of Asia which are more diverse than previously described and showing the hotspots in exons 14 and 5, accounting for 62% of mutant alleles. Almost all mutations identified are in class A/B. These data can benefit rapid molecular diagnosis of IOPD and severity rating of the mutations can serve as a partial substitute for cross reactive immunological material (CRIM) study.

    更新日期:2019-11-28
  • Metastatic colorectal cancer and severe hypocalcemia following irinotecan administration in a patient with X-linked agammaglobulinemia: a case report
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-09-12
    Mingming Li; Wei Chen; Xiaomeng Sun; Zhipeng Wang; Xun Zou; Hua Wei; Zhan Wang; Wansheng Chen

    X-linked agammaglobulinemia (XLA) is a primary immunodeficiency disorder caused by germline mutations in the Bruton tyrosine kinase (BTK) gene on X chromosome. These mutations disturb B-cell development, decrease immunoglobulin levels, increase susceptibility to infection or neoplasms, and increase the risk of developing colorectal cancer (CRC). For occasional cases of CRC have been reported in XLA patients, low levels of B lymphocytes and immunoglobulins induced by congenital immune disorder make them more susceptible to drug-related toxicities (DRT). Therefore, gene sequencing, therapeutic drug monitoring and any possible measurement to predict DRT should be considered before determining the course of chemotherapy for XLA patients with CRC. In this study, we reported a 21-year-old male who developed metastatic CRC in the context of XLA. Since the whole exome sequencing and therapeutic drug monitoring did not reveal any predictive markers of DRT, we applied standard first-line chemotherapy to the patient. However, progressive disease occurred after the fifth treatment cycle. Therefore, the administration of oxaliplatin was changed to irinotecan as second-line therapy. After that, the patient firstly suffered from severe hypocalcemia and eventually died due to metastatic CRC after the eighth treatment cycle. The overall survival time was 7.5 months. This study reported the first written record of a Chinese XLA patient with metastatic CRC and severe hypocalcemia. Whole exome sequencing and bioinformatic analysis indicated the somatic mutations in ABCA6, C6 and PAX3 genes might contribute to the early-onset and metastasis CRC. Besides, a number of germline mutations in genes related to calcium metabolism (CACNA2D4, CD36, etc.) and the administration of irinotecan were speculated to be the causes of severe hypocalcemia. We therefore suggested that in order to avoid severe DRT, clinicians should take genetic background and therapeutic drug monitoring into consideration while planning chemotherapy treatment for XLA patients with CRC.

    更新日期:2019-11-28
  • Clinical characteristics and mutation Spectrum of NF1 in 12 Chinese families with orbital/periorbital plexiform Neurofibromatosis type 1
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-09-18
    Peiwei Chai; Yingxiu Luo; Chuandi Zhou; Yefei Wang; Xianqun Fan; Renbing Jia

    Orbital/periorbital plexiform neurofibroma (OPPN) can compromise physical appearance and visual function. However, the clinical characteristics and NF1 mutation landscape in patients with heritable OPPN have not been reported. The medical charts of 26 Chinese patients with OPPN from 12 families were reviewed. Mutation analysis of the entire coding region and flanking splice sites of the NF1 gene was performed using next-generation sequencing (NGS). Novel NF1 mutations were confirmed by Sanger sequencing. Compared to the parental generation, a significantly larger proportion of OPPN patients in the successive generation presented with earlier onset (p = 0.001), amblyopia (p = 0.034), motility disorders (p = 0.009) and bony orbital expansion (p = 0.019). Six novel NF1 mutations were identified in 11 (91.67%) families, including 6 (42.9%) single-base substitutions, 4 (28.5%) splicing mutations, 3 (21.4%) frameshift deletions, and 1 (7.14%) intron mutation. The successive generation of OPPN patients presented with earlier onset and exhibited more severe ocular signs than did their parents or grandparents. Special attention should be paid to successive generations of OPPN patients. Considering that 6 mutations were novel, comprehensive NF1 mutation analysis is required or necessary or proposed for genetic counselling.

    更新日期:2019-11-28
  • IKZF1 genetic variants rs4132601 and rs11978267 and acute lymphoblastic leukemia risk in Tunisian children: a case-control study
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-10-11
    Sana Mahjoub; Vera Chayeb; Hedia Zitouni; Rabeb M. Ghali; Haifa Regaieg; Wassim Y. Almawi; Touhami Mahjoub

    Associations between IKZF1 gene variants and Acute Lymphoblastic Leukemia (ALL) was recently reported. We examined whether the common IKZF1 polymorphisms rs4132601 T/G and rs111978267 A/G are associated with ALL among a Tunisian pediatric cohort. This case-control study involved 170 patients with ALL and 150 control subjects. SNP genotyping was performed by TaqMan® SNP Genotyping Assay. The minor allele G of IKZF1 gene polymorphism rs4132601 T/G was significantly higher in ALL cases than in control subjects (P = 0.029), with 1.54-fold increased risk of ALL. The association of rs4132601 with ALL was seen under co-dominant (P = 0.009), recessive (P = 0.006), and additive (P = 0.027) genetic models, of which the co-dominant (P = 0.027) and recessive (P = 0.027) association remained significant after adjusting for covariates, and False Discovery Rate correction. In contrast, no association was noted for rs111978267 variant. Two-locus (rs4132601-rs11978267) IKZF1 haplotype analysis demonstrated association of GA (P = 0.053), with increased ALL risk [OR (95% CI) = 1.58 (1.00–2.51)], which remained significant after controlling for key covariates [aP = 0.046; aOR (95% CI) = 1.61 (1.01–2.57)]. We demonstrated the association of IKZF1 polymorphism rs4132601 T/G with increased risk of ALL among Tunisian pediatric cohort, with altered phenotypic changes among ALL patients.

    更新日期:2019-11-28
  • Uridine diphosphate glucuronosyl transferase 1A (UGT1A1) promoter polymorphism in young patients with sickle cell anaemia: report of the first cohort study from Nigeria
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-10-16
    Oladele Simeon Olatunya; Dulcineia Martins Albuquerque; Ganiyu Olusola Akanbi; Olufunso Simisola Aduayi; Adekunle Bamidele Taiwo; Opeyemi Ayodeji Faboya; Tolorunju Segun Kayode; Daniela Pinheiro Leonardo; Adekunle Adekile; Fernando Ferreira Costa

    (TA) n repeat sequence (rs8175347) of UGT1A1 gene promoter polymorphism is associated with serum bilirubin levels and gallstones among different sickle cell anaemia (SCA) populations. There are no data on UGT1A1 polymorphisms and their impact on Nigerian SCA patients. In this study, we determined the distribution of the UGT1A1 (TA) n genotypes among a group of young Nigerian SCA patients and healthy controls. In addition, the influence of UGT1A1 (TA) n genotypes on the laboratory and clinical events among the patients was determined. The distribution of the UGT1A1 (TA) n genotypes among 101 young Nigerian SCA patients and 64 normal appropriate controls were determined and studied. The UGT1A1 (TA) n genotypes were further classified into subgroups and used to differentiate the clinical events and laboratory parameters of the patients. Four (TA) n alleles:(TA)5, 6, 7, and 8 were found. These were associated with 10 genotypes: TA5/5, 5/6, 5/7, 5/8, 6/6, 6/7, 6/8, 7/7, 7/8, 8/8. The normal (wild-type)-(TA) 6/6), low- (TA) 7/7, 7/8, 8/8), intermediate- (TA) 5/7, 5/8, 6/7, 6/8), and high-activity (TA) 5/5, 5/6,) genotypes were found in 24.8, 24.8, 41.5, and 8.9% patients and 20.3, 15.6, 61, and 3.1% controls respectively. The general genotype distribution of the patients and control group were not significantly different. There were significant differences in serum bilirubin and lactate dehydrogenase (LDH) of the patients when differentiated by the UGT1A1 (TA) n genotypes (p<0.05). Asymptomatic gallstones were found in 5.9% of patients and were significantly of the low-activity genotypes sub-group 5 (20%) vs 1(1.3%) p = 0.0033. Although, bilirubin and fetal hemoglobin (HbF) of patients with gallstones were significantly different from those without gallstone, only the serum bilirubin was associated with UGT1A1 (TA) n genotypes on multivariate analysis (p < 0.0001). This study highlights the contribution of UGT1A1 polymorphisms, a non-globin genetic factor, to the laboratory and clinical manifestations of young Nigerian SCA patients for the first time. It also shows that children with co-inheritance of low UGT1A1 (TA) n affinity genotypes may be at risk of gallstone, hence the need to follow them up.

    更新日期:2019-11-28
  • Pooling analysis regarding the impact of human vitamin D receptor variants on the odds of psoriasis
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-10-17
    Juan Li; Li Sun; Jinghui Sun; Min Yan

    The study aims at scientifically investigating the genetic effect of four polymorphisms (rs7975232, rs1544410, rs2228570, and rs731236) within the human Vitamin D Receptor (VDR) gene on the odds of psoriasis through an updated meta-analysis. We searched eight databases and screened the studies for pooling. Finally, a total of eighteen eligible case-control studies were included. BH (Benjamini & Hochberg) adjusted P-values of association (Passociation) and odd ratios (ORs) with the corresponding 95% confidence intervals (CIs) were calculated under the allele, homozygote, heterozygote, dominant, recessive, and carrier models. Compared with the negative controls, no statistically significant difference in the odds of psoriasis was detected for the cases under any genetic models (BH adjusted Passociation > 0.05). We also performed subgroup meta-analyses by the source of controls, ethnicity, country, Hardy-Weinberg equilibrium, and genotyping method. Similar results were observed in most subgroup meta-analyses (BH adjusted Passociation > 0.05). Besides, data of Begg’s and Egger’s tests excluded the significant publication bias; while the sensitivity analysis data further indicated the statistical reliability of our pooling results. The currently available data fails to support a robust association between VDR rs7975232, rs1544410, rs2228570 and rs731236 polymorphisms and psoriasis susceptibility, which still required the support of more case-control studies.

    更新日期:2019-11-28
  • MMP-8 C-799 T, Lys460Thr, and Lys87Glu variants are not related to risk of cancer
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-10-21
    Li-Feng Zhang; Li-Jie Zhu; Wei Zhang; Wei Yuan; Ning-Hong Song; Li Zuo; Yuan-Yuan Mi; Zeng-Jun Wang; Wei Zhang

    Several studies have focused on the relationship between MMP-8 variants and cancer risk, but they have been unsuccessful in drawing reliable conclusions. We employed odds ratio (OR) together with 95% confidence interval (CI) to assess the correlation between MMP-8 C-799 T, Lys460Thr, and Lys87Glu polymorphisms and cancer risk. We further employed in silico tools to evaluate the effect of MMP-8 expression on cancer susceptibility and overall survival time. A total of 8140 patients with malignant carcinoma and 10,529 healthy individuals (control) were enrolled. Overall, the analysis showed that the relationship between three MMP-8 variants and cancer susceptibility was not significant (allelic contrast, C-799 T: OR = 0.98, 95% CI = 0.92–1.04, Pheterogeneity = 0.068; Lys460Thr: OR = 0.94, 95% CI = 0.67–1.32, Pheterogeneity = 0.905; Lys87Glu: OR = 1.05, 95% CI = 0.93–1.18, Pheterogeneity = 0.968). Similar results were observed in subgroup analysis by ethnicity, cancer type, and source of control. In silico analysis indicated that MMP-8 expression was elevated in bladder cancer tissue compared to that in the control. However, both the higher and lower MMP-8 expression groups did not show an impact on the overall survival time of the patients. MMP-8 C-799 T, Lys460Thr, and Lys87Glu variants are not participant with the susceptibility of cancer.

    更新日期:2019-11-28
  • MTHFR and F5 genetic variations have association with preeclampsia in Pakistani patients: a case control study
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-10-23
    Feriha Fatima Khidri; Yar Muhammad Waryah; Faiza Kamran Ali; Hina Shaikh; Ikram Din Ujjan; Ali Muhammad Waryah

    To study the role of single nucleotide variants (SNVs) of genes related to preeclampsia in Pakistani pregnant women. After ethical approval and getting informed consent; 250 pregnant women were enrolled and equally divided into two groups (125 preeclamptic cases and 125 normotensive pregnant women). Demographic details and medical history were recorded, and 10 ml blood sample was obtained for DNA extraction. The tetra-primer amplification refractory mutation system (ARMS) assays were developed for assessing the variants of three preeclampsia related genes; F5, MTHFR and VEGFA. An association of six SNVs; F5:c.1601G > A (rs6025), F5:c.6665A > G (rs6027), MTHFR: c.665C > T (rs1801133), MTHFR: c.1286A > C (rs1801131), VEGFA: c.-2055A > C (rs699947) and VEGFA: c.*237C > T (rs3025039) with preeclampsia was determined by using different genetic models. Genotyping of the SNVs revealed that patients with MTHFR:c.665C > T, have increased susceptibility to preeclampsia (CT versus CC/TT: OR = 2.79, 95% CI = 1.18–6.59; P* = 0.046 and CT/TT vs CC: OR = 2.91, 95% CI = 1.29–6.57; P* = 0.0497, in overdominant and dominant models, respectively), whereas F5:c.6665A > G, (A/G vs AA/GG: OR = 0.42, 95% CI = 0.21–0.84; P* = 0.038 in overdominant model) and MTHFR:c.1286A > C, (CC versus AA: OR = 0.36, 95% CI = 0.18–0.72; P* = 0.0392 in codominant model) have significantly decreased risk for preeclampsia. F5:c.1601G > A, VEGFA: c.-2055A > C and VEGFA: c.*237C > T variants revealed no relationship with the disease. This is the first case control study describing the protective role of F5:c.6665A > G against preeclampsia in any world population. In addition, the present study confirmed the association and role of MTHFR gene variations in the development of preeclampsia in Pakistani patients. Further genetic studies may be required to better understand the complex genetic mechanism of SNVs in preeclampsia related genes in pregnant women.

    更新日期:2019-11-28
  • Decoding of novel missense TSC2 gene variants using in-silico methods
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-10-26
    Shruthi Sudarshan; Manoj Kumar; Punit Kaur; Atin Kumar; Sethuraman G.; Savita Sapra; Sheffali Gulati; Neerja Gupta; Madhulika Kabra; Madhumita Roy Chowdhury

    Mutations in TSC1 or TSC2 gene cause tuberous sclerosis complex (TSC), an autosomal dominant disorder characterized by the formation of non-malignant hamartomas in multiple vital organs. TSC1 and TSC2 gene products form TSC heterodimer that senses specific cell growth conditions to control mTORC1 signalling. In the present study 98 TSC patients were tested for variants in TSC1 and TSC2 genes and 14 novel missense variations were identified. The pathogenecity of these novel variations was determined by applying different bioinformatics tools involving computer aided protein modeling. Protein modelling could be done only for ten variants which were within the functional part of the protein. Homology modeling is the most reliable method for structure prediction of a protein. Since no sequence homology structure was available for the tuberin protein, three dimensional structure was modeled by a combination of homology modeling and the predictive fold recognition and threading method using Phyre2 threading server. The best template structures for model building of the TSC1 interacting domain, tuberin domain and GAP domain are the crystal structures of clathrin adaptor core protein, Rap1GAP catalytic domain and Ser/Thr kinase Tor protein respectively. In this study, an attempt has been made to assess the impact of each novel missense variant based on their TSC1-TSC2 hydrophobic interactions and its effect on protein function.

    更新日期:2019-11-28
  • A steroid-resistant nephrotic syndrome in an infant resulting from a consanguineous marriage with COQ2 and ARSB gene mutations: a case report
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-10-28
    Xia Wu; Wenhong Wang; Yan Liu; Wenyu Chen; Linsheng Zhao

    Treatment of steroid-resistant nephrotic syndrome (SRNS) remains a challenge for paediatricians. SRNS accounts for 10~20% of childhood cases of nephrotic syndrome (NS). Individuals with SRNS overwhelmingly progress to chronic kidney disease (CKD) and end-stage kidney disease (ESRD). Genetic research is of great significance for diagnosis and treatment. More than 39 recessive or dominant genes have been found to cause human SRNS, including COQ2. COQ2 gene mutations not only cause primary coenzyme Q10 deficiency but also cause SRNS without extrarenal manifestations. The concept of COQ2 nephropathy has been proposed for a long time. Mutations in the COQ2 gene have rarely been reported. Worldwide, only 5 cases involving 4 families have been reported. We present the case of a 6-month-old girl with steroid-resistant glomerulopathy due to a COQ2 defect with no additional systemic symptoms. The patient was identified as a homozygote for the c.832 T > C (p. Cys278Arg) missense mutation and a single base homozygous mutation in ARSB gene in c.1213 + 1G > A. The father and mother were heterozygous mutation carriers in both COQ2 and ARSB, and her healthy sister was only a heterozygous mutation carrier in COQ2. In this case, hormone therapy was ineffective, and progressive deterioration of renal function occurred within 1 week after onset, leading to acute renal failure and eventual death. We reported a consanguinity married family which had COQ2 and ARSB dual mutant. Kidney diseases caused by COQ2 gene mutations can manifest as SRNS, with poor prognosis. The C. 832 T > c (p.csc 278arg) is a new mutation site. Genetic assessment for children with steroid-resistant nephrotic syndrome, especially in infancy, is very important. Families with a clear family history should receive genetic counselling and prenatal examinations, and children without a family phenotype should also receive genetic screening as early as possible.

    更新日期:2019-11-28
  • Homozygous missense variant in the TTN gene causing autosomal recessive limb-girdle muscular dystrophy type 10
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-10-29
    Amjad Khan; Rongrong Wang; Shirui Han; Muhammad Umair; Safdar Abbas; Muhammad Ismail Khan; Mohammad A. Alshabeeb; Majid Alfadhel; Xue Zhang

    Limb-girdle muscular dystrophies (LGMDs) are large group of heterogeneous genetic diseases, having a hallmark feature of muscle weakness. Pathogenic mutations in the gene encoding the giant skeletal muscle protein titin (TTN) are associated with several muscle disorders, including cardiomyopathy, recessive congenital myopathies and limb-girdle muscular dystrophy (LGMD) type10. The phenotypic spectrum of titinopathies is expanding, as next generation sequencing (NGS) technology makes screening of this large gene possible. This study aimed to identify the pathogenic variant in a consanguineous Pakistani family with autosomal recessive LGMD type 10. DNA from peripheral blood samples were obtained, whole exome sequencing (WES) was performed and several molecular and bioinformatics analysis were conducted to identify the pathogenic variant. TTN coding and near coding regions were further amplified using PCR and sequenced via Sanger sequencing. Whole exome sequencing analysis revealed a novel homozygous missense variant (c.98807G > A; p.Arg32936His) in the TTN gene in the index patients. No heterozygous individuals in the family presented LGMD features. The variant p.Arg32936His leads to a substitution of the arginine amino acid at position 32,936 into histidine possibly causing LGMD type 10. We identified a homozygous missense variant in TTN, which likely explains LGMD type 10 in this family in line with similar previously reported data. Our study concludes that WES is a successful molecular diagnostic tool to identify pathogenic variants in large genes such as TTN in highly inbred population.

    更新日期:2019-11-28
  • Clinical and molecular characterization of three patients with Hepatocerebral form of mitochondrial DNA depletion syndrome: a case series
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-10-29
    Ghazale Mahjoub; Parham Habibzadeh; Hassan Dastsooz; Malihe Mirzaei; Arghavan Kavosi; Laila Jamali; Haniyeh Javanmardi; Pegah Katibeh; Mohammad Ali Faghihi; Seyed Alireza Dastgheib

    Mitochondrial DNA depletion syndromes (MDS) are clinically and phenotypically heterogeneous disorders resulting from nuclear gene mutations. The affected individuals represent a notable reduction in mitochondrial DNA (mtDNA) content, which leads to malfunction of the components of the respiratory chain. MDS is classified according to the type of affected tissue; the most common type is hepatocerebral form, which is attributed to mutations in nuclear genes such as DGUOK and MPV17. These two genes encode mitochondrial proteins and play major roles in mtDNA synthesis. In this investigation patients in three families affected by hepatocerebral form of MDS who were initially diagnosed with tyrosinemia underwent full clinical evaluation. Furthermore, the causative mutations were identified using next generation sequencing and were subsequently validated using sanger sequencing. The effect of the mutations on the gene expression was also studied using real-time PCR. A pathogenic heterozygous frameshift deletion mutation in DGUOK gene was identified in parents of two affected patients (c.706–707 + 2 del: p.k236 fs) presenting with jaundice, impaired fetal growth, low-birth weight, and failure to thrive who died at the age of 3 and 6 months in family I. Moreover, a novel splice site mutation in MPV17 gene (c.461 + 1G > C) was identified in a patient with jaundice, muscle weakness, and failure to thrive who died due to hepatic failure at the age of 4 months. A 5-month-old infant presenting with jaundice, dark urine, poor sucking, and feeding problems was also identified to have another novel mutation in MPV17 gene leading to stop gain mutation (c.277C > T: p.(Gln93*)). These patients had overlapping clinical features with tyrosinemia. MDS should be considered a differential diagnosis in patients presenting with signs and symptoms of tyrosinemia.

    更新日期:2019-11-28
  • Associations of BAFF rs2893321 polymorphisms with myasthenia gravis susceptibility
    BMC Med. Genet. (IF 1.74) Pub Date : 2019-10-30
    Hui Deng; Jianjian Wang; Xiaotong Kong; Huixue Zhang; Tianfeng Wang; Wenqi Tian; Tingting Yi; Lihua Wang

    Myasthenia gravis (MG) is an autoimmune diseases characterized by fatigue and weakness of skeletal muscles. B-lymphocyte-activating factor (BAFF), an essential factor for B cell differentiation and development, is important in the progression of MG. The current study aimed to investigate the association between single nucleotide polymorphism rs2893321 in BAFF with MG susceptibility in Chinese Han population. One hundred forty-nine patients with MG and 148 healthy controls were recruited. Using improved multiple ligase detection reaction technology, the polymorphisms of rs2893321 between groups and among MG subgroups have been compared. A significant differences between the MG group and the healthy control group was observed. Additionally, rs2893321 was found to be associated with gender and age in patients with MG. Genetic variations of rs2893321 in BAFF might be associated with susceptibility to MG in the Chinese Han population.

    更新日期:2019-11-28
Contents have been reproduced by permission of the publishers.
导出
全部期刊列表>>
2020新春特辑
限时免费阅读临床医学内容
ACS材料视界
科学报告最新纳米科学与技术研究
清华大学化学系段昊泓
自然科研论文编辑服务
加州大学洛杉矶分校
上海纽约大学William Glover
南开大学化学院周其林
课题组网站
X-MOL
北京大学分子工程苏南研究院
华东师范大学分子机器及功能材料
中山大学化学工程与技术学院
试剂库存
天合科研
down
wechat
bug