显示样式:     当前分类: 医药    当前期刊: Journal of Clinical Investigation    加入关注    导出
我的关注
我的收藏
您暂时未登录!
登录
  • Microglia in steady state
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-07-17
    Katrin Kierdorf; Marco Prinz

    Microglial cells are the resident tissue macrophages of the CNS and are widely recognized for their immune surveillance of the healthy CNS. In addition to this well-accepted function, recent findings point to major roles for microglia in instructing and regulating the proper function of the neuronal networks in the adult CNS, but these cells are also involved in creating neuronal networks by orchestrating construction of the whole network during development. In this Review, we highlight recent findings about the steady-state functions of microglial cells, the factors that are important for physiological microglial function, and how microglia help to maintain tissue homeostasis in the CNS.

    更新日期:2017-09-08
  • Understanding the functions and relationships of the glymphatic system and meningeal lymphatics
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-09-01
    Antoine Louveau; Benjamin A. Plog; Salli Antila; Kari Alitalo; Maiken Nedergaard; Jonathan Kipnis

    Recent discoveries of the glymphatic system and of meningeal lymphatic vessels have generated a lot of excitement, along with some degree of skepticism. Here, we summarize the state of the field and point out the gaps of knowledge that should be filled through further research. We discuss the glymphatic system as a system that allows CNS perfusion by the cerebrospinal fluid (CSF) and interstitial fluid (ISF). We also describe the recently characterized meningeal lymphatic vessels and their role in drainage of the brain ISF, CSF, CNS-derived molecules, and immune cells from the CNS and meninges to the peripheral (CNS-draining) lymph nodes. We speculate on the relationship between the two systems and their malfunction that may underlie some neurological diseases. Although much remains to be investigated, these new discoveries have changed our understanding of mechanisms underlying CNS immune privilege and CNS drainage. Future studies should explore the communications between the glymphatic system and meningeal lymphatics in CNS disorders and develop new therapeutic modalities targeting these systems.

    更新日期:2017-09-08
  • Transcriptional control of microglia phenotypes in health and disease
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-07-31
    Inge R. Holtman; Dylan Skola; Christopher K. Glass

    Microglia are the main resident macrophage population of the CNS and perform numerous functions required for CNS development, homeostasis, immunity, and repair. Many lines of evidence also indicate that dysregulation of microglia contributes to the pathogenesis of neurodegenerative and behavioral diseases. These observations provide a compelling argument to more clearly define the mechanisms that control microglia identity and function in health and disease. In this Review, we present a conceptual framework for how different classes of transcription factors interact to select and activate regulatory elements that control microglia development and their responses to internal and external signals. We then describe functions of specific transcription factors in normal and pathological contexts and conclude with a consideration of open questions to be addressed in the future.

    更新日期:2017-09-08
  • Microglia in prion diseases
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-07-17
    Adriano Aguzzi; Caihong Zhu

    Prion diseases are a group of progressive and fatal neurodegenerative disorders characterized by deposition of scrapie prion protein (PrPSc) in the CNS. This deposition is accompanied by neuronal loss, spongiform change, astrogliosis, and conspicuous microglial activation. Here, we argue that microglia play an overall neuroprotective role in prion pathogenesis. Several microglia-related molecules, such as Toll-like receptors (TLRs), the complement system, cytokines, chemokines, inflammatory regulators, and phagocytosis mediators, are involved in prion pathogenesis. However, the molecular mechanisms underlying the microglial response to prion infection are largely unknown. Consequently, we lack a comprehensive understanding of the regulatory network of microglial activation. On the positive side, recent findings suggest that therapeutic strategies modulating microglial activation and function may have merit in prion disease. Moreover, studies on the role of microglia in prion disease could deepen our understanding of neuroinflammation in a broad range of neurodegenerative disorders.

    更新日期:2017-09-08
  • Microglia in Alzheimer’s disease
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-09-01
    Heela Sarlus; Michael T. Heneka

    Microglia are brain-resident myeloid cells that mediate key functions to support the CNS. Microglia express a wide range of receptors that act as molecular sensors, which recognize exogenous or endogenous CNS insults and initiate an immune response. In addition to their classical immune cell function, microglia act as guardians of the brain by promoting phagocytic clearance and providing trophic support to ensure tissue repair and maintain cerebral homeostasis. Conditions associated with loss of homeostasis or tissue changes induce several dynamic microglial processes, including changes of cellular morphology, surface phenotype, secretory mediators, and proliferative responses (referred to as an “activated state”). Activated microglia represent a common pathological feature of several neurodegenerative diseases, including Alzheimer’s disease (AD). Cumulative evidence suggests that microglial inflammatory activity in AD is increased while microglial-mediated clearance mechanisms are compromised. Microglia are perpetually engaged in a mutual interaction with the surrounding environment in CNS; thus, diverse microglial reactions at different disease stages may open new avenues for therapeutic intervention and modification of inflammatory activities. In this Review, the role of microglia in the pathogenesis of AD and the modulation of microglia activity as a therapeutic modality will be discussed.

    更新日期:2017-09-08
  • Microglia and C9orf72 in neuroinflammation and ALS and frontotemporal dementia
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-07-24
    Deepti Lall; Robert H. Baloh

    Amyotrophic lateral sclerosis (ALS) is a degenerative disorder that is characterized by loss of motor neurons and shows clinical, pathological, and genetic overlap with frontotemporal dementia (FTD). Activated microglia are a universal feature of ALS/FTD pathology; however, their role in disease pathogenesis remains incompletely understood. The recent discovery that ORF 72 on chromosome 9 (C9orf72), the gene most commonly mutated in ALS/FTD, has an important role in myeloid cells opened the possibility that altered microglial function plays an active role in disease. This Review highlights the contribution of microglia to ALS/FTD pathogenesis, discusses the connection between autoimmunity and ALS/FTD, and explores the possibility that C9orf72 and other ALS/FTD genes may have a “dual effect” on both neuronal and myeloid cell function that could explain a shared propensity for altered systemic immunity and neurodegeneration.

    更新日期:2017-09-08
  • Cell biology of spinal cord injury and repair
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-07-24
    Timothy M. O’Shea; Joshua E. Burda; Michael V. Sofroniew

    Spinal cord injury (SCI) lesions present diverse challenges for repair strategies. Anatomically complete injuries require restoration of neural connectivity across lesions. Anatomically incomplete injuries may benefit from augmentation of spontaneous circuit reorganization. Here, we review SCI cell biology, which varies considerably across three different lesion-related tissue compartments: (a) non-neural lesion core, (b) astrocyte scar border, and (c) surrounding spared but reactive neural tissue. After SCI, axon growth and circuit reorganization are determined by neuron-cell-autonomous mechanisms and by interactions among neurons, glia, and immune and other cells. These interactions are shaped by both the presence and the absence of growth-modulating molecules, which vary markedly in different lesion compartments. The emerging understanding of how SCI cell biology differs across lesion compartments is fundamental to developing rationally targeted repair strategies.

    更新日期:2017-09-08
  • Oligodendroglia: metabolic supporters of neurons
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-09-01
    Thomas Philips; Jeffrey D. Rothstein

    Oligodendrocytes are glial cells that populate the entire CNS after they have differentiated from oligodendrocyte progenitor cells. From birth onward, oligodendrocytes initiate wrapping of neuronal axons with a multilamellar lipid structure called myelin. Apart from their well-established function in action potential propagation, more recent data indicate that oligodendrocytes are essential for providing metabolic support to neurons. Oligodendrocytes transfer energy metabolites to neurons through cytoplasmic “myelinic” channels and monocarboxylate transporters, which allow for the fast delivery of short-carbon-chain energy metabolites like pyruvate and lactate to neurons. These substrates are metabolized and contribute to ATP synthesis in neurons. This Review will discuss our current understanding of this metabolic supportive function of oligodendrocytes and its potential impact in human neurodegenerative disease and related animal models.

    更新日期:2017-09-08
  • Epigenetics at the base of alternative splicing changes that promote colorectal cancer
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-21
    Alberto R. Kornblihtt

    Chromatin modification influences gene expression by either repressing or activating genes, depending on the specific histone mark. Chromatin structure can also influence alternative splicing of transcripts; however, the mechanisms by which epigenetic marks influence splicing are poorly understood. A report in the current issue of the JCI highlights the biological importance of the coordinated control of alternative pre-mRNA splicing by chromatin structure and transcriptional elongation. Yuan et al. found that mutation of the histone methyl transferase SEDT2 affects alternative splicing fates of several key regulatory genes, including those involved in Wnt signaling. As a consequence, loss of SEDT2 in the intestine aggravated Wnt/β-catenin signaling effects, thereby leading to colorectal cancer.

    更新日期:2017-09-08
  • Patience pays in spinal repair
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-21
    Steven A. Goldman

    Transplantation of human neural stem cells has long been proposed as a potential strategy for treating CNS injury and disease; however, application of this approach has had limited therapeutic benefit. Yet compared with rodents and other experimental mammals, humans have a relatively long time window for development of the brain and spinal cord. In this issue of the JCI, Lu and colleagues asked whether the results of neural stem cell transplantation might be improved by accommodating the protracted development of human neural cells. They used a rodent model of spinal cord injury, in which human neural progenitor cells were transplanted at the site of damage. While there was no observable benefit at early time points after transplantation, both anatomic and functional improvements in the injured animals emerged over the course of a year. In particular, the human progenitor cell population differentiated, matured, and integrated into the rodent spinal cords over a time frame that aligned with the normal development of these cells in humans. This study demonstrates that neural stem cells may offer significant therapeutic benefit after CNS injury; however, this process may take time and demands patience on the part of investigators, patients, and clinicians alike.

    更新日期:2017-09-08
  • Prolonged human neural stem cell maturation supports recovery in injured rodent CNS
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-21
    Paul Lu; Steven Ceto; Yaozhi Wang; Lori Graham; Di Wu; Hiromi Kumamaru; Eileen Staufenberg; Mark H. Tuszynski

    Neural stem cells (NSCs) differentiate into both neurons and glia, and strategies using human NSCs have the potential to restore function following spinal cord injury (SCI). However, the time period of maturation for human NSCs in adult injured CNS is not well defined, posing fundamental questions about the design and implementation of NSC-based therapies. This work assessed human H9 NSCs that were implanted into sites of SCI in immunodeficient rats over a period of 1.5 years. Notably, grafts showed evidence of continued maturation over the entire assessment period. Markers of neuronal maturity were first expressed 3 months after grafting. However, neurogenesis, neuronal pruning, and neuronal enlargement continued over the next year, while total graft size remained stable over time. Axons emerged early from grafts in very high numbers, and half of these projections persisted by 1.5 years. Mature astrocyte markers first appeared after 6 months, while more mature oligodendrocyte markers were not present until 1 year after grafting. Astrocytes slowly migrated from grafts. Notably, functional recovery began more than 1 year after grafting. Thus, human NSCs retain an intrinsic human rate of maturation, despite implantation into the injured rodent spinal cord, yet they support delayed functional recovery, a finding of great importance in planning human clinical trials.

    更新日期:2017-09-08
  • Stromal cell cadherin-11 regulates adipose tissue inflammation and diabetes
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-07-31
    Sook Kyung Chang; Ayano C. Kohlgruber; Fumitaka Mizoguchi; Xavier Michelet; Benjamin J. Wolf; Kevin Wei; Pui Y. Lee; Lydia Lynch; Danielle Duquette; Victòria Ceperuelo-Mallafré; Alexander S. Banks; Michael B. Brenner

    M2 macrophages, innate lymphoid type 2 cells (ILC2s), eosinophils, Tregs, and invariant NK T cells (iNKT cells) all help to control adipose tissue inflammation, while M1 macrophages, TNF, and other inflammatory cytokines drive inflammation and insulin resistance in obesity. Stromal cells regulate leukocyte responses in lymph nodes, but the role of stromal cells in adipose tissue inflammation is unknown. PDGFRα+ stromal cells are major producers of IL-33 in adipose tissue. Here, we show that mesenchymal cadherin-11 modulates stromal fibroblast function. Cadherin-11–deficient mice displayed increased stromal production of IL-33, with concomitant enhancements in ILC2s and M2 macrophages that helped control adipose tissue inflammation. Higher expression levels of IL-33 in cadherin-11–deficient mice mediated ILC2 activation, resulting in higher IL-13 expression levels and M2 macrophage expansion in adipose tissue. Consistent with reduced adipose tissue inflammation, cadherin-11–deficient mice were protected from obesity-induced glucose intolerance and adipose tissue fibrosis. Importantly, anti–cadherin-11 mAb blockade similarly improved inflammation and glycemic control in obese WT mice. These results suggest that stromal fibroblasts expressing cadherin-11 regulate adipose tissue inflammation and thus highlight cadherin-11 as a potential therapeutic target for the management of obesity.

    更新日期:2017-09-08
  • TNF is required for TLR ligand–mediated but not protease-mediated allergic airway inflammation
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-07-31
    Gregory S. Whitehead; Seddon Y. Thomas; Karim H. Shalaby; Keiko Nakano; Timothy P. Moran; James M. Ward; Gordon P. Flake; Hideki Nakano; Donald N. Cook

    Asthma is associated with exposure to a wide variety of allergens and adjuvants. The extent to which overlap exists between the cellular and molecular mechanisms triggered by these various agents is poorly understood, but it might explain the differential responsiveness of patients to specific therapies. In particular, it is unclear why some, but not all, patients benefit from blockade of TNF. Here, we characterized signaling pathways triggered by distinct types of adjuvants during allergic sensitization. Mice sensitized to an innocuous protein using TLR ligands or house dust extracts as adjuvants developed mixed eosinophilic and neutrophilic airway inflammation and airway hyperresponsiveness (AHR) following allergen challenge, whereas mice sensitized using proteases as adjuvants developed predominantly eosinophilic inflammation and AHR. TLR ligands, but not proteases, induced TNF during allergic sensitization. TNF signaled through airway epithelial cells to reprogram them and promote Th2, but not Th17, development in lymph nodes. TNF was also required during the allergen challenge phase for neutrophilic and eosinophilic inflammation. In contrast, TNF was dispensable for allergic airway disease in a protease-mediated model of asthma. These findings might help to explain why TNF blockade improves lung function in only some patients with asthma.

    更新日期:2017-09-08
  • Parathyroid hormone regulates fates of murine osteoblast precursors in vivo
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-07-31
    Deepak H. Balani; Noriaki Ono; Henry M. Kronenberg

    Teriparatide, a recombinant form of parathyroid hormone (PTH), is the only approved treatment for osteoporosis that increases the rate of bone formation. Teriparatide increases osteoblast numbers by suppressing osteoblast apoptosis and activating bone-lining cells. No direct evidence for teriparatide’s actions on early cells of the osteoblast lineage has been demonstrated. Here, we have employed a lineage-tracing strategy that uses a tamoxifen-dependent, promoter-driven cre to mark early cells of the osteoblast lineage in adult mice. We show that teriparatide increases the numbers of osteoblast precursors and drives their differentiation into mature osteoblasts. Unexpectedly, following withdrawal of teriparatide therapy, bone marrow adipocytes increased dramatically in number. Some of these adipocytes derived from cells marked by Sox9-cre expression weeks earlier. Continued therapy with teriparatide prevented the appearance of adipocytes. Selective, inducible deletion of the PTH receptor in Sox9-cre cells demonstrated that PTH receptor expression is required for teriparatide-mediated increases in early osteoblast precursors. The increase in early precursors after teriparatide administration was associated with robust suppression of precursor apoptosis without affecting their rate of proliferation. Thus, teriparatide increases the numbers of early cells of the osteoblast lineage, hastens their differentiation into osteoblasts, and suppresses their differentiation into adipocytes in vivo.

    更新日期:2017-09-08
  • Activin-A enhances mTOR signaling to promote aberrant chondrogenesis in fibrodysplasia ossificans progressiva
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-07-31
    Kyosuke Hino; Kazuhiko Horigome; Megumi Nishio; Shingo Komura; Sanae Nagata; Chengzhu Zhao; Yonghui Jin; Koichi Kawakami; Yasuhiro Yamada; Akira Ohta; Junya Toguchida; Makoto Ikeya

    Fibrodysplasia ossificans progressiva (FOP) is a rare and intractable disease characterized by extraskeletal bone formation through endochondral ossification. Patients with FOP harbor point mutations in ACVR1, a type I receptor for BMPs. Although mutated ACVR1 (FOP-ACVR1) has been shown to render hyperactivity in BMP signaling, we and others have uncovered a mechanism by which FOP-ACVR1 mistransduces BMP signaling in response to Activin-A, a molecule that normally transduces TGF-β signaling. Although Activin-A evokes enhanced chondrogenesis in vitro and heterotopic ossification (HO) in vivo, the underlying mechanisms have yet to be revealed. To this end, we developed a high-throughput screening (HTS) system using FOP patient–derived induced pluripotent stem cells (FOP-iPSCs) to identify pivotal pathways in enhanced chondrogenesis that are initiated by Activin-A. In a screen of 6,809 small-molecule compounds, we identified mTOR signaling as a critical pathway for the aberrant chondrogenesis of mesenchymal stromal cells derived from FOP-iPSCs (FOP-iMSCs). Two different HO mouse models, an FOP model mouse expressing FOP-ACVR1 and an FOP-iPSC–based HO model mouse, revealed critical roles for mTOR signaling in vivo. Moreover, we identified ENPP2, an enzyme that generates lysophosphatidic acid, as a linker of FOP-ACVR1 and mTOR signaling in chondrogenesis. These results uncovered the crucial role of the Activin-A/FOP-ACVR1/ENPP2/mTOR axis in FOP pathogenesis.

    更新日期:2017-09-08
  • Epiregulin and EGFR interactions are involved in pain processing
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-07
    Loren J. Martin; Shad B. Smith; Arkady Khoutorsky; Claire A. Magnussen; Alexander Samoshkin; Robert E. Sorge; Chulmin Cho; Noosha Yosefpour; Sivaani Sivaselvachandran; Sarasa Tohyama; Tiffany Cole; Thang M. Khuong; Ellen Mir; Dustin G. Gibson; Jeffrey S. Wieskopf; Susana G. Sotocinal; Jean Sebastien Austin; Carolina B. Meloto; Joseph H. Gitt; Christos Gkogkas; Nahum Sonenberg; Joel D. Greenspan; Roger B. Fillingim; Richard Ohrbach; Gary D. Slade; Charles Knott; Ronald Dubner; Andrea G. Nackley; Alfredo Ribeiro-da-Silva; G. Gregory Neely; William Maixner; Dmitri V. Zaykin; Jeffrey S. Mogil; Luda Diatchenko

    The EGFR belongs to the well-studied ErbB family of receptor tyrosine kinases. EGFR is activated by numerous endogenous ligands that promote cellular growth, proliferation, and tissue regeneration. In the present study, we have demonstrated a role for EGFR and its natural ligand, epiregulin (EREG), in pain processing. We show that inhibition of EGFR with clinically available compounds strongly reduced nocifensive behavior in mouse models of inflammatory and chronic pain. EREG-mediated activation of EGFR enhanced nociception through a mechanism involving the PI3K/AKT/mTOR pathway and matrix metalloproteinase-9. Moreover, EREG application potentiated capsaicin-induced calcium influx in a subset of sensory neurons. Both the EGFR and EREG genes displayed a genetic association with the development of chronic pain in several clinical cohorts of temporomandibular disorder. Thus, EGFR and EREG may be suitable therapeutic targets for persistent pain conditions.

    更新日期:2017-09-08
  • Phenotypic and pharmacogenetic evaluation of patients with thiazide-induced hyponatremia
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-07
    James S. Ware; Louise V. Wain; Sarath K. Channavajjhala; Victoria E. Jackson; Elizabeth Edwards; Run Lu; Keith Siew; Wenjing Jia; Nick Shrine; Sue Kinnear; Mahli Jalland; Amanda P. Henry; Jenny Clayton; Kevin M. O’Shaughnessy; Martin D. Tobin; Victor L. Schuster; Stuart Cook; Ian P. Hall; Mark Glover

    Thiazide diuretics are among the most widely used treatments for hypertension, but thiazide-induced hyponatremia (TIH), a clinically significant adverse effect, is poorly understood. Here, we have studied the phenotypic and genetic characteristics of patients hospitalized with TIH. In a cohort of 109 TIH patients, those with severe TIH displayed an extended phenotype of intravascular volume expansion, increased free water reabsorption, urinary prostaglandin E2 excretion, and reduced excretion of serum chloride, magnesium, zinc, and antidiuretic hormone. GWAS in a separate cohort of 48 TIH patients and 2,922 controls from the 1958 British birth cohort identified an additional 14 regions associated with TIH. We identified a suggestive association with a variant in SLCO2A1, which encodes a prostaglandin transporter in the distal nephron. Resequencing of SLCO2A1 revealed a nonsynonymous variant, rs34550074 (p.A396T), and association with this SNP was replicated in a second cohort of TIH cases. TIH patients with the p.A396T variant demonstrated increased urinary excretion of prostaglandin E2 and metabolites. Moreover, the SLCO2A1 phospho-mimic p.A396E showed loss of transporter function in vitro. These findings indicate that the phenotype of TIH involves a more extensive metabolic derangement than previously recognized. We propose one mechanism underlying TIH development in a subgroup of patients in which SLCO2A1 regulation is altered.

    更新日期:2017-09-08
  • Histone methyltransferase SETD2 modulates alternative splicing to inhibit intestinal tumorigenesis
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-21
    Huairui Yuan; Ni Li; Da Fu; Jiale Ren; Jingyi Hui; Junjie Peng; Yongfeng Liu; Tong Qiu; Min Jiang; Qiang Pan; Ying Han; Xiaoming Wang; Qintong Li; Jun Qin

    The histone H3K36 methyltransferase SETD2 is frequently mutated or deleted in a variety of human tumors. Nevertheless, the role of SETD2 loss in oncogenesis remains largely undefined. Here, we found that SETD2 counteracts Wnt signaling and its inactivation promotes intestinal tumorigenesis in mouse models of colorectal cancer (CRC). SETD2 was not required for intestinal homeostasis under steady state; however, upon irradiation, genetic inactivation of Setd2 in mouse intestinal epithelium facilitated the self-renewal of intestinal stem/progenitor cells as well as tissue regeneration. Furthermore, depletion of SETD2 enhanced the susceptibility to tumorigenesis in the context of dysregulated Wnt signaling. Mechanistic characterizations indicated that SETD2 downregulation affects the alternative splicing of a subset of genes implicated in tumorigenesis. Importantly, we uncovered that SETD2 ablation reduces intron retention of dishevelled segment polarity protein 2 (DVL2) pre-mRNA, which would otherwise be degraded by nonsense-mediated decay, thereby augmenting Wnt signaling. The signaling cascades mediated by SETD2 were further substantiated by a CRC patient cohort analysis. Together, our studies highlight SETD2 as an integral regulator of Wnt signaling through epigenetic regulation of RNA processing during tissue regeneration and tumorigenesis.

    更新日期:2017-09-08
  • 27-Hydroxycholesterol induces hematopoietic stem cell mobilization and extramedullary hematopoiesis during pregnancy
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-07
    Hideyuki Oguro; Jeffrey G. McDonald; Zhiyu Zhao; Michihisa Umetani; Philip W. Shaul; Sean J. Morrison

    Extramedullary hematopoiesis (EMH) is induced during pregnancy to support rapid expansion of maternal blood volume. EMH activation requires hematopoietic stem cell (HSC) proliferation and mobilization, processes that depend upon estrogen receptor α (ERα) in HSCs. Here we show that treating mice with estradiol to model estradiol increases during pregnancy induced HSC proliferation in the bone marrow but not HSC mobilization. Treatment with the alternative ERα ligand 27-hydroxycholesterol (27HC) induced ERα-dependent HSC mobilization and EMH but not HSC division in the bone marrow. During pregnancy, 27HC levels increased in hematopoietic stem/progenitor cells as a result of CYP27A1, a cholesterol hydroxylase. Cyp27a1-deficient mice had significantly reduced 27HC levels, HSC mobilization, and EMH during pregnancy but normal bone marrow hematopoiesis and EMH in response to bleeding or G-CSF treatment. Distinct hematopoietic stresses thus induce EMH through different mechanisms. Two different ERα ligands, estradiol and 27HC, work together to promote EMH during pregnancy, revealing a collaboration of hormonal and metabolic mechanisms as well as a physiological function for 27HC in normal mice.

    更新日期:2017-09-08
  • The atypical antipsychotic olanzapine causes weight gain by targeting serotonin receptor 2C
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-14
    Caleb C. Lord; Steven C. Wyler; Rong Wan; Carlos M. Castorena; Newaz Ahmed; Dias Mathew; Syann Lee; Chen Liu; Joel K. Elmquist

    Atypical antipsychotics such as olanzapine often induce excessive weight gain and type 2 diabetes. However, the mechanisms underlying these drug-induced metabolic perturbations remain poorly understood. Here, we used an experimental model that reproduces olanzapine-induced hyperphagia and obesity in female C57BL/6 mice. We found that olanzapine treatment acutely increased food intake, impaired glucose tolerance, and altered physical activity and energy expenditure in mice. Furthermore, olanzapine-induced hyperphagia and weight gain were blunted in mice lacking the serotonin 2C receptor (HTR2C). Finally, we showed that treatment with the HTR2C-specific agonist lorcaserin suppressed olanzapine-induced hyperphagia and weight gain. Lorcaserin treatment also improved glucose tolerance in olanzapine-fed mice. Collectively, our studies suggest that olanzapine exerts some of its untoward metabolic effects via antagonism of HTR2C.

    更新日期:2017-09-08
  • Prolyl hydroxylase 2 inactivation enhances glycogen storage and promotes excessive neutrophilic responses
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-14
    Pranvera Sadiku; Joseph A. Willson; Rebecca S. Dickinson; Fiona Murphy; Alison J. Harris; Amy Lewis; David Sammut; Ananda S. Mirchandani; Eilise Ryan; Emily R. Watts; A.A. Roger Thompson; Helen M. Marriott; David H. Dockrell; Cormac T. Taylor; Martin Schneider; Patrick H. Maxwell; Edwin R. Chilvers; Massimilliano Mazzone; Veronica Moral; Chris W. Pugh; Peter J. Ratcliffe; Christopher J. Schofield; Bart Ghesquiere; Peter Carmeliet; Moira K.B. Whyte; Sarah R. Walmsley

    Fully activated innate immune cells are required for effective responses to infection, but their prompt deactivation and removal are essential for limiting tissue damage. Here, we have identified a critical role for the prolyl hydroxylase enzyme Phd2 in maintaining the balance between appropriate, predominantly neutrophil-mediated pathogen clearance and resolution of the innate immune response. We demonstrate that myeloid-specific loss of Phd2 resulted in an exaggerated inflammatory response to Streptococcus pneumonia, with increases in neutrophil motility, functional capacity, and survival. These enhanced neutrophil responses were dependent upon increases in glycolytic flux and glycogen stores. Systemic administration of a HIF–prolyl hydroxylase inhibitor replicated the Phd2-deficient phenotype of delayed inflammation resolution. Together, these data identify Phd2 as the dominant HIF-hydroxylase in neutrophils under normoxic conditions and link intrinsic regulation of glycolysis and glycogen stores to the resolution of neutrophil-mediated inflammatory responses. These results demonstrate the therapeutic potential of targeting metabolic pathways in the treatment of inflammatory disease.

    更新日期:2017-09-08
  • The FOXN3-NEAT1-SIN3A repressor complex promotes progression of hormonally responsive breast cancer
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-14
    Wanjin Li; Zihan Zhang; Xinhua Liu; Xiao Cheng; Yi Zhang; Xiao Han; Yu Zhang; Shumeng Liu; Jianguo Yang; Bosen Xu; Lin He; Luyang Sun; Jing Liang; Yongfeng Shang

    The pathophysiological function of the forkhead transcription factor FOXN3 remains to be explored. Here we report that FOXN3 is a transcriptional repressor that is physically associated with the SIN3A repressor complex in estrogen receptor–positive (ER+) cells. RNA immunoprecipitation–coupled high-throughput sequencing identified that NEAT1, an estrogen-inducible long noncoding RNA, is required for FOXN3 interactions with the SIN3A complex. ChIP-Seq and deep sequencing of RNA genomic targets revealed that the FOXN3-NEAT1-SIN3A complex represses genes including GATA3 that are critically involved in epithelial-to-mesenchymal transition (EMT). We demonstrated that the FOXN3-NEAT1-SIN3A complex promotes EMT and invasion of breast cancer cells in vitro as well as dissemination and metastasis of breast cancer in vivo. Interestingly, the FOXN3-NEAT1-SIN3A complex transrepresses ER itself, forming a negative-feedback loop in transcription regulation. Elevation of both FOXN3 and NEAT1 expression during breast cancer progression corresponded to diminished GATA3 expression, and high levels of FOXN3 and NEAT1 strongly correlated with higher histological grades and poor prognosis. Our experiments uncovered that NEAT1 is a facultative component of the SIN3A complex, shedding light on the mechanistic actions of NEAT1 and the SIN3A complex. Further, our study identified the ERα-NEAT1-FOXN3/NEAT1/SIN3A-GATA3 axis that is implicated in breast cancer metastasis, providing a mechanistic insight into the pathophysiological function of FOXN3.

    更新日期:2017-09-08
  • YAP/TAZ regulates sprouting angiogenesis and vascular barrier maturation
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-14
    Jongshin Kim; Yoo Hyung Kim; Jaeryung Kim; Do Young Park; Hosung Bae; Da-Hye Lee; Kyun Hoo Kim; Seon Pyo Hong; Seung Pil Jang; Yoshiaki Kubota; Young-Guen Kwon; Dae-Sik Lim; Gou Young Koh

    Angiogenesis is a multistep process that requires coordinated migration, proliferation, and junction formation of vascular endothelial cells (ECs) to form new vessel branches in response to growth stimuli. Major intracellular signaling pathways that regulate angiogenesis have been well elucidated, but key transcriptional regulators that mediate these signaling pathways and control EC behaviors are only beginning to be understood. Here, we show that YAP/TAZ, a transcriptional coactivator that acts as an end effector of Hippo signaling, is critical for sprouting angiogenesis and vascular barrier formation and maturation. In mice, endothelial-specific deletion of Yap/Taz led to blunted-end, aneurysm-like tip ECs with fewer and dysmorphic filopodia at the vascular front, a hyper-pruned vascular network, reduced and disarranged distributions of tight and adherens junction proteins, disrupted barrier integrity, subsequent hemorrhage in growing retina and brain vessels, and reduced pathological choroidal neovascularization. Mechanistically, YAP/TAZ activates actin cytoskeleton remodeling, an important component of filopodia formation and junction assembly. Moreover, YAP/TAZ coordinates EC proliferation and metabolic activity by upregulating MYC signaling. Overall, these results show that YAP/TAZ plays multifaceted roles for EC behaviors, proliferation, junction assembly, and metabolism in sprouting angiogenesis and barrier formation and maturation and could be a potential therapeutic target for treating neovascular diseases.

    更新日期:2017-09-08
  • Clinical and immunological responses after CD30-specific chimeric antigen receptor–redirected lymphocytes
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-14
    Carlos A. Ramos; Brandon Ballard; Huimin Zhang; Olga Dakhova; Adrian P. Gee; Zhuyong Mei; Mrinalini Bilgi; Meng-Fen Wu; Hao Liu; Bambi Grilley; Catherine M. Bollard; Bill H. Chang; Cliona M. Rooney; Malcolm K. Brenner; Helen E. Heslop; Gianpietro Dotti; Barbara Savoldo

    BACKGROUND. Targeting CD30 with monoclonal antibodies in Hodgkin lymphoma (HL) and anaplastic large cell lymphoma (ALCL) has had profound clinical success. However, adverse events, mainly mediated by the toxin component of the conjugated antibodies, cause treatment discontinuation in many patients. Targeting CD30 with T cells expressing a CD30-specific chimeric antigen receptor (CAR) may reduce the side effects and augment antitumor activity.

    更新日期:2017-09-08
  • Treg depletion potentiates checkpoint inhibition in claudin-low breast cancer
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-21
    Nicholas A. Taylor; Sarah C. Vick; Michael D. Iglesia; W. June Brickey; Bentley R. Midkiff; Karen P. McKinnon; Shannon Reisdorf; Carey K. Anders; Lisa A. Carey; Joel S. Parker; Charles M. Perou; Benjamin G. Vincent; Jonathan S. Serody

    Claudin-low breast cancer is an aggressive subtype that confers poor prognosis and is found largely within the clinical triple-negative group of breast cancer patients. Here, we have shown that intrinsic and immune cell gene signatures distinguish the claudin-low subtype clinically as well as in mouse models of other breast cancer subtypes. Despite adaptive immune cell infiltration in claudin-low tumors, treatment with immune checkpoint inhibitory antibodies against cytotoxic T lymphocyte–associated protein 4 (CTLA-4) and programmed death receptor 1 (PD-1) were ineffective in controlling tumor growth. CD4+FoxP3+ Tregs represented a large proportion of the tumor-infiltrating lymphocytes (TILs) in claudin-low tumors, and Tregs isolated from tumor-bearing mice were able to suppress effector T cell responses. Tregs in the tumor microenvironment highly expressed PD-1 and were recruited partly through tumor generation of the chemokine CXCL12. Antitumor efficacy required stringent Treg depletion combined with checkpoint inhibition; delays in tumor growth were not observed using therapies that modestly diminished the number of Tregs in the tumor microenvironment. This study provides evidence that the recruitment of Tregs to the tumor microenvironment inhibits an effective antitumor immune response and highlights early Treg recruitment as a possible mechanism for the lack of response to immune checkpoint blockade antibodies in specific subtypes of cancer that are heavily infiltrated with adaptive immune cells.

    更新日期:2017-09-08
  • Ultrasensitive mutation detection identifies rare residual cells causing acute myelogenous leukemia relapse
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-21
    Brian Parkin; Angelina Londoño-Joshi; Qing Kang; Muneesh Tewari; Andrew D. Rhim; Sami N. Malek

    Acute myelogenous leukemia (AML) frequently relapses after complete remission (CR), necessitating improved detection and phenotypic characterization of treatment-resistant residual disease. In this work, we have optimized droplet digital PCR to broadly measure mutated alleles of recurrently mutated genes in CR marrows of AML patients at levels as low as 0.002% variant allele frequency. Most gene mutations persisted in CR, albeit at highly variable and gene-dependent levels. The majority of AML cases demonstrated residual aberrant oligoclonal hematopoiesis. Importantly, we detected very rare cells (as few as 1 in 15,000) that were genomically similar to the dominant blast populations at diagnosis and were fully clonally represented at relapse, identifying these rare cells as one common source of AML relapse. Clinically, the mutant allele burden was associated with overall survival in AML, and our findings narrow the repertoire of gene mutations useful in minimal residual disease–based prognostication in AML. Overall, this work delineates rare cell populations that cause AML relapse, with direct implications for AML research directions and strategies to improve AML therapies and outcome.

    更新日期:2017-09-08
  • Peripherally derived FGF21 promotes remyelination in the central nervous system
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-21
    Mariko Kuroda; Rieko Muramatsu; Noriko Maedera; Yoshihisa Koyama; Machika Hamaguchi; Harutoshi Fujimura; Mari Yoshida; Morichika Konishi; Nobuyuki Itoh; Hideki Mochizuki; Toshihide Yamashita

    Demyelination in the central nervous system (CNS) leads to severe neurological deficits that can be partially reversed by spontaneous remyelination. Because the CNS is isolated from the peripheral milieu by the blood-brain barrier, remyelination is thought to be controlled by the CNS microenvironment. However, in this work we found that factors derived from peripheral tissue leak into the CNS after injury and promote remyelination in a murine model of toxin-induced demyelination. Mechanistically, leakage of circulating fibroblast growth factor 21 (FGF21), which is predominantly expressed by the pancreas, drives proliferation of oligodendrocyte precursor cells (OPCs) through interactions with β-klotho, an essential coreceptor of FGF21. We further confirmed that human OPCs expressed β-klotho and proliferated in response to FGF21 in vitro. Vascular barrier disruption is a common feature of many CNS disorders; thus, our findings reveal a potentially important role for the peripheral milieu in promoting CNS regeneration.

    更新日期:2017-09-08
  • Macrophage-derived IL-10 mediates mucosal repair by epithelial WISP-1 signaling
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-07
    Miguel Quiros; Hikaru Nishio; Philipp A. Neumann; Dorothee Siuda; Jennifer C. Brazil; Veronica Azcutia; Roland Hilgarth; Monique N. O’Leary; Vicky Garcia-Hernandez; Giovanna Leoni; Mingli Feng; Gabriela Bernal; Holly Williams; Priya H. Dedhia; Christian Gerner-Smidt; Jason Spence; Charles A. Parkos; Timothy L. Denning; Asma Nusrat

    In response to injury, epithelial cells migrate and proliferate to cover denuded mucosal surfaces and repair the barrier defect. This process is orchestrated by dynamic crosstalk between immune cells and the epithelium; however, the mechanisms involved remain incompletely understood. Here, we report that IL-10 was rapidly induced following intestinal mucosal injury and was required for optimal intestinal mucosal wound closure. Conditional deletion of IL-10 specifically in CD11c-expressing cells in vivo implicated macrophages as a critical innate immune contributor to IL-10–induced wound closure. Consistent with these findings, wound closure in T cell– and B cell–deficient Rag1–/– mice was unimpaired, demonstrating that adaptive immune cells are not absolutely required for this process. Further, following mucosal injury, macrophage-derived IL-10 resulted in epithelial cAMP response element–binding protein (CREB) activation and subsequent synthesis and secretion of the pro-repair WNT1-inducible signaling protein 1 (WISP-1). WISP-1 induced epithelial cell proliferation and wound closure by activating epithelial pro-proliferative pathways. These findings define the involvement of macrophages in regulating an IL-10/CREB/WISP-1 signaling axis, with broad implications in linking innate immune activation to mucosal wound repair.

    更新日期:2017-09-08
  • NBEAL2 is required for neutrophil and NK cell function and pathogen defense
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-07
    John M. Sowerby; David C. Thomas; Simon Clare; Marion Espéli; Jose A. Guerrero; Kim Hoenderdos; Katherine Harcourt; Morgan Marsden; Juneid Abdul-Karim; Mathew Clement; Robin Antrobus; Yagnesh Umrania; Philippa R. Barton; Shaun M. Flint; Jatinder K. Juss; Alison M. Condliffe; Paul A. Lyons; Ian R. Humphreys; Edwin R. Chilvers; Willem H. Ouwehand; Gordon Dougan; Kenneth G.C. Smith

    Mutations in the human NBEAL2 gene cause gray platelet syndrome (GPS), a bleeding diathesis characterized by a lack of α granules in platelets. The functions of the NBEAL2 protein have not been explored outside platelet biology, but there are reports of increased frequency of infection and abnormal neutrophil morphology in patients with GPS. We therefore investigated the role of NBEAL2 in immunity by analyzing the phenotype of Nbeal2-deficient mice. We found profound abnormalities in the Nbeal2-deficient immune system, particularly in the function of neutrophils and NK cells. Phenotyping of Nbeal2-deficient neutrophils showed a severe reduction in granule contents across all granule subsets. Despite this, Nbeal2-deficient neutrophils had an enhanced phagocyte respiratory burst relative to Nbeal2-expressing neutrophils. This respiratory burst was associated with increased expression of cytosolic components of the NADPH oxidase complex. Nbeal2-deficient NK cells were also dysfunctional and showed reduced degranulation. These abnormalities were associated with increased susceptibility to both bacterial (Staphylococcus aureus) and viral (murine CMV) infection in vivo. These results define an essential role for NBEAL2 in mammalian immunity.

    更新日期:2017-09-08
  • GATA4 loss of function in liver cancer impedes precursor to hepatocyte transition
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-07-31
    Francis O. Enane; Wai Ho Shuen; Xiaorong Gu; Ebrahem Quteba; Bartlomiej Przychodzen; Hideki Makishima; Juraj Bodo; Joanna Ng; Chit Lai Chee; Rebecca Ba; Lip Seng Koh; Janice Lim; Rachael Cheong; Marissa Teo; Zhenbo Hu; Kwok Peng Ng; Jaroslaw Maciejewski; Tomas Radivoyevitch; Alexander Chung; London Lucien Ooi; Yu Meng Tan; Peng-Chung Cheow; Pierce Chow; Chung Yip Chan; Kiat Hon Lim; Lisa Yerian; Eric Hsi; Han Chong Toh; Yogen Saunthararajah

    The most frequent chromosomal structural loss in hepatocellular carcinoma (HCC) is of the short arm of chromosome 8 (8p). Genes on the remaining homologous chromosome, however, are not recurrently mutated, and the identity of key 8p tumor-suppressor genes (TSG) is unknown. In this work, analysis of minimal commonly deleted 8p segments to identify candidate TSG implicated GATA4, a master transcription factor driver of hepatocyte epithelial lineage fate. In a murine model, liver-conditional deletion of 1 Gata4 allele to model the haploinsufficiency seen in HCC produced enlarged livers with a gene expression profile of persistent precursor proliferation and failed hepatocyte epithelial differentiation. HCC mimicked this gene expression profile, even in cases that were morphologically classified as well differentiated. HCC with intact chromosome 8p also featured GATA4 loss of function via GATA4 germline mutations that abrogated GATA4 interactions with a coactivator, MED12, or by inactivating mutations directly in GATA4 coactivators, including ARID1A. GATA4 reintroduction into GATA4-haploinsufficient HCC cells or ARID1A reintroduction into ARID1A-mutant/GATA4-intact HCC cells activated hundreds of hepatocyte genes and quenched the proliferative precursor program. Thus, disruption of GATA4-mediated transactivation in HCC suppresses hepatocyte epithelial differentiation to sustain replicative precursor phenotype.

    更新日期:2017-09-08
  • Inborn errors in RNA polymerase III underlie severe varicella zoster virus infections
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-08-07
    Benson Ogunjimi; Shen-Ying Zhang; Katrine B. Sørensen; Kristian A. Skipper; Madalina Carter-Timofte; Gaspard Kerner; Stefanie Luecke; Thaneas Prabakaran; Yujia Cai; Josephina Meester; Esther Bartholomeus; Nikhita Ajit Bolar; Geert Vandeweyer; Charlotte Claes; Yasmine Sillis; Lazaro Lorenzo; Raffaele A. Fiorenza; Soraya Boucherit; Charlotte Dielman; Steven Heynderickx; George Elias; Andrea Kurotova; Ann Vander Auwera; Lieve Verstraete; Lieven Lagae; Helene Verhelst; Anna Jansen; Jose Ramet; Arvid Suls; Evelien Smits; Berten Ceulemans; Lut Van Laer; Genevieve Plat Wilson; Jonas Kreth; Capucine Picard; Horst Von Bernuth; Joël Fluss; Stephane Chabrier; Laurent Abel; Geert Mortier; Sebastien Fribourg; Jacob Giehm Mikkelsen; Jean-Laurent Casanova; Søren R. Paludan; Trine H. Mogensen

    Varicella zoster virus (VZV) typically causes chickenpox upon primary infection. In rare cases, VZV can give rise to life-threatening disease in otherwise healthy people, but the immunological basis for this remains unexplained. We report 4 cases of acute severe VZV infection affecting the central nervous system or the lungs in unrelated, otherwise healthy children who are heterozygous for rare missense mutations in POLR3A (one patient), POLR3C (one patient), or both (two patients). POLR3A and POLR3C encode subunits of RNA polymerase III. Leukocytes from all 4 patients tested exhibited poor IFN induction in response to synthetic or VZV-derived DNA. Moreover, leukocytes from 3 of the patients displayed defective IFN production upon VZV infection and reduced control of VZV replication. These phenotypes were rescued by transduction with relevant WT alleles. This work demonstrates that monogenic or digenic POLR3A and POLR3C deficiencies confer increased susceptibility to severe VZV disease in otherwise healthy children, providing evidence for an essential role of a DNA sensor in human immunity.

    更新日期:2017-09-08
  • The U2AF1S34F mutation induces lineage-specific splicing alterations in myelodysplastic syndromes
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-09-01
    Bon Ham Yip; Violetta Steeples; Emmanouela Repapi; Richard N. Armstrong; Miriam Llorian; Swagata Roy; Jacqueline Shaw; Hamid Dolatshad; Stephen Taylor; Amit Verma; Matthias Bartenstein; Paresh Vyas; Nicholas C.P. Cross; Luca Malcovati; Mario Cazzola; Eva Hellström-Lindberg; Seishi Ogawa; Christopher W.J. Smith; Andrea Pellagatti; Jacqueline Boultwood

    Original citation: J Clin Invest. 2017;127(6):2206–2221. https://doi.org/10.1172/JCI91363 Citation for this corrigendum: J Clin Invest. 2017;127(9):3557. https://doi.org/10.1172/JCI96202 In Figure 4D, the horizontal axes of the two graphs were labeled incorrectly, and one sentence in the legend for this part was also incorrect. The correct figure part and sentence are below. Expression of H2AFY isoform 1.1 and the STRAP long isoform in U2AF1S34F and U2AF1WT transduced cells was measured by isoform-specific qRT-PCR relative to the EV control (red bars: erythroid cells; blue bars: granulomonocytic cells). The authors regret the error. Footnotes See the related article at The U2AF1S34F mutation induces lineage-specific splicing alterations in myelodysplastic syndromes.

    更新日期:2017-09-08
  • A therapeutic T cell receptor mimic antibody targets tumor-associated PRAME peptide/HLA-I antigens
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-09-01
    Aaron Y. Chang; Tao Dao; Ron S. Gejman; Casey A. Jarvis; Andrew Scott; Leonid Dubrovsky; Melissa D. Mathias; Tatyana Korontsvit; Victoriya Zakhaleva; Michael Curcio; Ronald C. Hendrickson; Cheng Liu; David A. Scheinberg

    Original citation: J Clin Invest. 2017;127(7):2705–2718. https://doi.org/10.1172/JCI92335 Citation for this corrigendum: J Clin Invest. 2017;127(9):3557. https://doi.org/10.1172/JCI96860 The last two sentences in the first paragraph of the Discussion section were incorrect. The correct sentences are below. Recently described “ImmTAC” molecules use a TCR-based recognition domain offering similar reactivity to TCRm Abs and demonstrate high affinity (42). Also, TCRm Abs such as Pr20 can target these “undruggable” proteins with high affinity for redirected immune-mediated cytolysis. The authors regret the error. Footnotes See the related article at A therapeutic T cell receptor mimic antibody targets tumor-associated PRAME peptide/HLA-I antigens.

    更新日期:2017-09-08
  • Isolated polycystic liver disease genes define effectors of polycystin-1 function
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-09-01
    Whitney Besse; Ke Dong; Jungmin Choi; Sohan Punia; Sorin V. Fedeles; Murim Choi; Anna-Rachel Gallagher; Emily B. Huang; Ashima Gulati; James Knight; Shrikant Mane; Esa Tahvanainen; Pia Tahvanainen; Simone Sanna-Cherchi; Richard P. Lifton; Terry Watnick; York P. Pei; Vicente E. Torres; Stefan Somlo

    Original citation: J Clin Invest. 2017;127(5):1772–1785. https://doi.org/10.1172/JCI90129 Citation for this corrigendum: J Clin Invest. 2017;127(9):3558. https://doi.org/10.1172/JCI96729 In the original article, the RT-PCR primer sequences listed in Methods were incorrectly labeled as Pkd1. The correct primer sequences for Pkd1 are in the revised paragraph below. Quantitative PCR and reverse transcription PCR. RNA was isolated from cultured cells using Trizol Reagent (Invitrogen). cDNA was reverse transcribed from RNA using reagents from New England Biolabs. Primers for Pkd1 quantitative PCR (forward, GCTACAGGGCATCCTGGTG; reverse, GGCTGTCAGCGAGAGCTTGAA) were designed using NCBI’s primer-designing tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). Quantitative PCR was done by Bio-Rad CFX Connect Real-Time PCR Detection System. Primers for Xbp1 RT-PCR have been published previously (1). The authors regret the error. Footnotes See the related article at Isolated polycystic liver disease genes define effectors of polycystin-1 function. References Iwakoshi NN, Lee AH, Vallabhajosyula P, Otipoby KL, Rajewsky K, Glimcher LH. Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-1. Nat Immunol. 2003;4(4):321–329.View this article via: PubMed CrossRef Google Scholar

    更新日期:2017-09-08
  • Neuropeptide FF increases M2 activation and self-renewal of adipose tissue macrophages
    J. Clin. Invest. (IF 12.784) Pub Date : 2017-07-31
    Syed F. Hassnain Waqas; Anh Cuong Hoang; Ya-Tin Lin; Grace Ampem; Hind Azegrouz; Lajos Balogh; Julianna Thuróczy; Jin-Chung Chen; Ivan C. Gerling; Sorim Nam; Jong-Seok Lim; Juncal Martinez-Ibañez; José T. Real; Stephan Paschke; Raphaëlle Quillet; Safia Ayachi; Frédéric Simonin; E. Marion Schneider; Jacqueline A. Brinkman; Dudley W. Lamming; Christine M. Seroogy; Tamás Röszer

    Original citation: J Clin Invest. 2017;127(7):2842–2854. https://doi.org/10.1172/JCI90152 Citation for this corrigendum: J Clin Invest. 2017;127(9):3559. https://doi.org/10.1172/JCI95841 During the assembly of Figure 1D, an incorrect image was inadvertently used for the human omental fat sample. The correct figure panel is below. The authors regret the error. Footnotes See the related article at Neuropeptide FF increases M2 activation and self-renewal of adipose tissue macrophages.

    更新日期:2017-09-08
Some contents have been Reproduced with permission of the American Chemical Society.
Some contents have been Reproduced by permission of The Royal Society of Chemistry.
所有期刊列表A-Z